ID: 1093031090

View in Genome Browser
Species Human (GRCh38)
Location 12:14289101-14289123
Sequence ATTACATAGTCCACTGCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093031083_1093031090 8 Left 1093031083 12:14289070-14289092 CCACTCTGAACAGTTGTGCCCAG No data
Right 1093031090 12:14289101-14289123 ATTACATAGTCCACTGCTATGGG No data
1093031087_1093031090 -10 Left 1093031087 12:14289088-14289110 CCCAGTGGGGAAAATTACATAGT No data
Right 1093031090 12:14289101-14289123 ATTACATAGTCCACTGCTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093031090 Original CRISPR ATTACATAGTCCACTGCTAT GGG Intergenic
No off target data available for this crispr