ID: 1093031869

View in Genome Browser
Species Human (GRCh38)
Location 12:14295939-14295961
Sequence GACAGCTGTTGGCCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093031869_1093031873 15 Left 1093031869 12:14295939-14295961 CCAGTAACAGGCCAACAGCTGTC No data
Right 1093031873 12:14295977-14295999 AGTTATCTGCGGAAGATGGCAGG No data
1093031869_1093031872 11 Left 1093031869 12:14295939-14295961 CCAGTAACAGGCCAACAGCTGTC No data
Right 1093031872 12:14295973-14295995 GAGTAGTTATCTGCGGAAGATGG No data
1093031869_1093031874 16 Left 1093031869 12:14295939-14295961 CCAGTAACAGGCCAACAGCTGTC No data
Right 1093031874 12:14295978-14296000 GTTATCTGCGGAAGATGGCAGGG No data
1093031869_1093031871 4 Left 1093031869 12:14295939-14295961 CCAGTAACAGGCCAACAGCTGTC No data
Right 1093031871 12:14295966-14295988 AAAAAAAGAGTAGTTATCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093031869 Original CRISPR GACAGCTGTTGGCCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr