ID: 1093031873

View in Genome Browser
Species Human (GRCh38)
Location 12:14295977-14295999
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093031866_1093031873 25 Left 1093031866 12:14295929-14295951 CCACCAAAGCCCAGTAACAGGCC 0: 144
1: 161
2: 86
3: 68
4: 218
Right 1093031873 12:14295977-14295999 AGTTATCTGCGGAAGATGGCAGG No data
1093031868_1093031873 16 Left 1093031868 12:14295938-14295960 CCCAGTAACAGGCCAACAGCTGT 0: 6
1: 191
2: 200
3: 162
4: 245
Right 1093031873 12:14295977-14295999 AGTTATCTGCGGAAGATGGCAGG No data
1093031869_1093031873 15 Left 1093031869 12:14295939-14295961 CCAGTAACAGGCCAACAGCTGTC No data
Right 1093031873 12:14295977-14295999 AGTTATCTGCGGAAGATGGCAGG No data
1093031870_1093031873 4 Left 1093031870 12:14295950-14295972 CCAACAGCTGTCTCTTAAAAAAA No data
Right 1093031873 12:14295977-14295999 AGTTATCTGCGGAAGATGGCAGG No data
1093031867_1093031873 22 Left 1093031867 12:14295932-14295954 CCAAAGCCCAGTAACAGGCCAAC 0: 5
1: 187
2: 172
3: 109
4: 201
Right 1093031873 12:14295977-14295999 AGTTATCTGCGGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093031873 Original CRISPR AGTTATCTGCGGAAGATGGC AGG Intergenic
No off target data available for this crispr