ID: 1093032240

View in Genome Browser
Species Human (GRCh38)
Location 12:14298776-14298798
Sequence GTGGAAAGACGGCCTGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093032232_1093032240 24 Left 1093032232 12:14298729-14298751 CCATCATTGTTGTCCAAGAAGCG No data
Right 1093032240 12:14298776-14298798 GTGGAAAGACGGCCTGGGCCAGG No data
1093032234_1093032240 11 Left 1093032234 12:14298742-14298764 CCAAGAAGCGCAAGGTTTATCTT No data
Right 1093032240 12:14298776-14298798 GTGGAAAGACGGCCTGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093032240 Original CRISPR GTGGAAAGACGGCCTGGGCC AGG Intergenic
No off target data available for this crispr