ID: 1093033657

View in Genome Browser
Species Human (GRCh38)
Location 12:14312662-14312684
Sequence CAAATATTCCACATTTATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093033657_1093033658 -7 Left 1093033657 12:14312662-14312684 CCTTTATAAATGTGGAATATTTG No data
Right 1093033658 12:14312678-14312700 ATATTTGAATGAATGAGAGATGG No data
1093033657_1093033659 -6 Left 1093033657 12:14312662-14312684 CCTTTATAAATGTGGAATATTTG No data
Right 1093033659 12:14312679-14312701 TATTTGAATGAATGAGAGATGGG No data
1093033657_1093033660 -5 Left 1093033657 12:14312662-14312684 CCTTTATAAATGTGGAATATTTG No data
Right 1093033660 12:14312680-14312702 ATTTGAATGAATGAGAGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093033657 Original CRISPR CAAATATTCCACATTTATAA AGG (reversed) Intergenic
No off target data available for this crispr