ID: 1093044783

View in Genome Browser
Species Human (GRCh38)
Location 12:14430446-14430468
Sequence GAGAGCACAAAAATTCACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 206}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093044780_1093044783 0 Left 1093044780 12:14430423-14430445 CCCCGCTAGGTTTTGCTTTTAAA 0: 1
1: 0
2: 0
3: 14
4: 277
Right 1093044783 12:14430446-14430468 GAGAGCACAAAAATTCACATAGG 0: 1
1: 0
2: 1
3: 17
4: 206
1093044781_1093044783 -1 Left 1093044781 12:14430424-14430446 CCCGCTAGGTTTTGCTTTTAAAG 0: 1
1: 0
2: 0
3: 28
4: 530
Right 1093044783 12:14430446-14430468 GAGAGCACAAAAATTCACATAGG 0: 1
1: 0
2: 1
3: 17
4: 206
1093044782_1093044783 -2 Left 1093044782 12:14430425-14430447 CCGCTAGGTTTTGCTTTTAAAGA 0: 1
1: 0
2: 2
3: 31
4: 293
Right 1093044783 12:14430446-14430468 GAGAGCACAAAAATTCACATAGG 0: 1
1: 0
2: 1
3: 17
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093044783 Original CRISPR GAGAGCACAAAAATTCACAT AGG Intronic
900774188 1:4569646-4569668 GAGAGCAGAAATGTTGACATTGG + Intergenic
900957712 1:5897724-5897746 CAGATCAAAAAAATACACATGGG + Intronic
901495567 1:9619451-9619473 GAGAGTTCCAAAATTCACTTGGG + Intergenic
905506977 1:38487703-38487725 CAGAGCACCAAACTCCACATGGG - Intergenic
908746652 1:67382999-67383021 GAGAACAGACTAATTCACATGGG - Intronic
909311423 1:74154804-74154826 GAGAGAACATAATCTCACATTGG - Intronic
909947489 1:81679857-81679879 GAGACCAAAAAAAATCACAGTGG + Intronic
911310922 1:96290999-96291021 GGGAGGACAAATATTCACAGAGG - Intergenic
911834298 1:102596634-102596656 GAGATATCAAAAATTCAAATCGG - Intergenic
912017228 1:105055935-105055957 GAGTGCAGAAAAATACATATTGG - Intergenic
915539996 1:156559587-156559609 GAGAGCAGAAGACTTCACAGAGG + Intronic
916540982 1:165753728-165753750 TAGAGCCCAAGAATTCACAGTGG + Intronic
916660110 1:166915726-166915748 TAGTCCACAAAATTTCACATAGG - Exonic
918746782 1:188211473-188211495 GAGTGCACACAATTTCACATGGG - Intergenic
918829004 1:189367092-189367114 TCAAGCACAAATATTCACATTGG + Intergenic
919283838 1:195526883-195526905 GAGAGCAGAAGACTTCACCTGGG + Intergenic
919564330 1:199165055-199165077 TAGAACACAAAAACTCAAATTGG - Intergenic
920757146 1:208743446-208743468 GAAAGCACAAATATTAGCATTGG + Intergenic
921108853 1:212013116-212013138 CAGAGCTGAAAAATTCATATTGG + Intronic
921960334 1:221027424-221027446 GAGAACACAAAATTTCCCATGGG + Intergenic
922819594 1:228474911-228474933 GACAGCAGAAAAATGCAAATGGG + Intergenic
924250649 1:242129816-242129838 GAGAGTAGAATAATTGACATTGG - Intronic
1063023052 10:2148394-2148416 GAAAGCACCAATATTCACAATGG - Intergenic
1063161989 10:3424792-3424814 GAGAGCACTAATGTCCACATGGG + Intergenic
1063365900 10:5490671-5490693 AAGATCACAGAAATTCATATTGG - Intergenic
1065263879 10:23955149-23955171 TAGAACACAAAAGTTCACAGAGG + Intronic
1065351757 10:24802159-24802181 GAGAGGAAAAAAATACACAACGG - Intergenic
1067909092 10:50326311-50326333 GAGAGCTGAAAAATTCACTCTGG - Intronic
1068351485 10:55851592-55851614 GAGATCACAAAAATTTAATTTGG - Intergenic
1070475444 10:76824833-76824855 GAGTGCTCCAAAATCCACATGGG + Intergenic
1074398328 10:113119149-113119171 GAGAGCACACGAATTCGCAGCGG - Intronic
1074408175 10:113199161-113199183 GAGAGCTCAAAAATCCATTTTGG + Intergenic
1076714660 10:132357568-132357590 CAGTGCACAAAAACTCTCATTGG + Intronic
1077560074 11:3254819-3254841 GAGAGCACTAATGTCCACATGGG - Intergenic
1077565967 11:3300622-3300644 GAGAGCACTAATGTCCACATGGG - Intergenic
1077832213 11:5885702-5885724 GAGAGCATTAAAATAAACATGGG - Intronic
1078702971 11:13707144-13707166 GAGAGCCCAAATATTCACTATGG - Intronic
1081418057 11:42839584-42839606 GTCAGCACAAAAATGCAAATGGG + Intergenic
1082776356 11:57247679-57247701 GAGTGGAGAAAAATTCACGTAGG + Intergenic
1085285296 11:75355931-75355953 GAGAACACAAAACTTTACAAGGG + Intergenic
1085967500 11:81545913-81545935 GAAAGGAAAAAAAATCACATGGG - Intergenic
1087623487 11:100568866-100568888 GTGAGGATAAAAATTCAAATAGG + Intergenic
1090376705 11:126294681-126294703 GGGGGCACAAAAGTACACATTGG - Intronic
1090513292 11:127398243-127398265 GAGAGCTCAAATAATCACTTTGG + Intergenic
1090679846 11:129043269-129043291 GAGAGCACCAAACATCAAATTGG - Intronic
1091515008 12:1170540-1170562 GAGGGCACATAAATCCACAACGG - Intronic
1091879058 12:3961934-3961956 GAGAGAACAAAAAGCCACAGTGG + Intergenic
1091967350 12:4755686-4755708 TAGAGCACAAAAATTCAGGTTGG - Intronic
1092047990 12:5446217-5446239 GAGGGCACAACAACTCACAGAGG + Intronic
1093044783 12:14430446-14430468 GAGAGCACAAAAATTCACATAGG + Intronic
1093944184 12:25088180-25088202 CAGAGAACAAAAGTTCACATGGG - Intronic
1095198610 12:39355387-39355409 GAGAGCATAAGAACTCATATAGG + Intronic
1097802180 12:63926798-63926820 AAGAGTACAAAGTTTCACATTGG - Intronic
1099471523 12:83055432-83055454 GAGAGCATAAAAAAGCAGATTGG + Intronic
1099620134 12:84993078-84993100 GAGAGCAAAATATTTCACTTTGG - Intergenic
1099707291 12:86172228-86172250 GAAACCAAAAAAATTAACATAGG + Intronic
1099789060 12:87307215-87307237 GAGGGCACAAAATTTCATTTAGG - Intergenic
1100840415 12:98607238-98607260 GAAAATACAAAAATTCACTTAGG + Intergenic
1106846299 13:33741386-33741408 CAGAGCACAGACATGCACATAGG - Intergenic
1108101837 13:46965266-46965288 GAGAACAGAAAAATTCATGTGGG - Intergenic
1108154765 13:47574151-47574173 CAGAACACAAACATTCATATTGG + Intergenic
1108412829 13:50167471-50167493 GAGGACACCAAAATTCACAGAGG - Intronic
1109955371 13:69558606-69558628 GATAGGACTAAAATTTACATTGG + Intergenic
1110587622 13:77213170-77213192 GAGAGCACAAAAATGTAAACAGG + Intronic
1110672787 13:78201593-78201615 GAGAGCACAGAAAGTCCCAGAGG - Intergenic
1112102937 13:96210113-96210135 GATAGCAAAAAAGTACACATAGG - Intronic
1113477167 13:110592229-110592251 AAGAGTACAGAAATTCATATAGG - Intergenic
1116217162 14:42031718-42031740 AAAACCACAAAAATTCACAGTGG + Intergenic
1116755124 14:48938210-48938232 GAGAACCATAAAATTCACATTGG - Intergenic
1117181111 14:53192750-53192772 GAGAGCAGAAAAATCATCATAGG - Intergenic
1122596398 14:102895948-102895970 GAGAATACAAAAAATTACATGGG - Intronic
1123150647 14:106178278-106178300 GTGAGCACAAAAATTTTCAAGGG + Intergenic
1124101216 15:26695602-26695624 GAGAGAAAAAAAATTTACATAGG + Intronic
1125117113 15:36107279-36107301 GAGAGAAGAAAAATTGACAGAGG - Intergenic
1126274509 15:46861180-46861202 AAGAGGTCAGAAATTCACATTGG + Intergenic
1126897318 15:53272890-53272912 GAGAGGAAAAAAACTCAGATGGG - Intergenic
1127844414 15:62856915-62856937 GACAGCACAGGAATGCACATGGG + Intergenic
1131302924 15:91215304-91215326 GTGAGCACAAAAATTACCCTGGG + Intronic
1131371583 15:91886219-91886241 CAGAGCACAAAAATCCACATTGG + Intronic
1135864685 16:26090496-26090518 GGGTGCACAAAATTTCCCATGGG + Intronic
1135935757 16:26778606-26778628 GAAAGCACAAAAAATCTCCTGGG + Intergenic
1138068537 16:53967187-53967209 GAGAGCACAAACAGTAACCTAGG - Intronic
1138877680 16:60972787-60972809 GAGAGTACCAAAATTCCCAGTGG + Intergenic
1138987869 16:62353144-62353166 GAGGGCAGAAAAATCCAAATGGG + Intergenic
1139280902 16:65769639-65769661 GAAAGGACAAAAATGTACATGGG - Intergenic
1139649125 16:68353340-68353362 GAGAGAACAAAGATCCACAACGG - Intronic
1150360624 17:64530479-64530501 AAGAGGAAAAAAATTCACCTAGG - Intronic
1150543335 17:66126868-66126890 CAGAGCACAAAAATTAACTCTGG + Intronic
1154332126 18:13438762-13438784 GAAAGTAGAAAAATTTACATGGG + Intronic
1155715908 18:28943431-28943453 GAGGGCACATAACTGCACATAGG - Intergenic
1156464257 18:37338827-37338849 GAGAGCAGAACAAGCCACATGGG + Intronic
1159335589 18:67061067-67061089 GAGAGCAAACAAATTCAAAAAGG + Intergenic
1160255518 18:77245070-77245092 AGGAGCACAGAAATTCACCTGGG + Intergenic
1164091737 19:21959312-21959334 GAGAGAAGAACACTTCACATGGG - Intronic
1165828151 19:38717317-38717339 GTGAGCACCAGGATTCACATGGG + Intronic
1165970988 19:39629680-39629702 GATAGCACAAACATGCTCATGGG - Intergenic
1167836578 19:52076901-52076923 GAAAGTACAAAAATGCACAAGGG + Intronic
925753246 2:7109036-7109058 TAGAGCTCAAAAACTCAAATTGG - Intergenic
925948726 2:8891328-8891350 GAGAGCTCAGAAATGCAAATTGG + Intronic
927975842 2:27337534-27337556 GAGAGCAGAAACATTCATACTGG - Exonic
930204315 2:48572955-48572977 GAGGGCACAAAAACACACAGCGG - Intronic
930424576 2:51196390-51196412 GAGAAGACAGAAATTCACATAGG - Intergenic
930634883 2:53793296-53793318 GAAACCAAACAAATTCACATTGG - Intronic
933065299 2:77785400-77785422 GAGAACAAATAAATTAACATTGG - Intergenic
935043812 2:99460955-99460977 GAGAGCACCCTTATTCACATAGG - Intronic
935113815 2:100116415-100116437 GACAGCACAAAAATAGACAAAGG - Intronic
935188861 2:100759566-100759588 TTGTGCACAAAAATTCACTTGGG - Intergenic
935538558 2:104322988-104323010 GAGAACACTAAAGCTCACATAGG - Intergenic
935981999 2:108636554-108636576 TAGAGGACAAAGATTCACAGAGG + Intronic
937642498 2:124229429-124229451 GAGAGAACAAAAATTCTATTTGG - Intronic
938612404 2:132961108-132961130 TAAAGCATAAAAATCCACATGGG + Intronic
940854518 2:158719304-158719326 TAGATCACAAAAATTCAGAAAGG - Intergenic
941467568 2:165847541-165847563 GATAGAACAAAATTTCACTTTGG + Intergenic
943087293 2:183328081-183328103 AAGGGTACAAAGATTCACATAGG - Intergenic
943405549 2:187478663-187478685 AAAAGCACAAATATTAACATAGG + Intronic
944212581 2:197221830-197221852 GAAAGCACAAAAAGTCAGAGAGG + Intronic
944413120 2:199461192-199461214 GAGAGGACAAAAACCCACACCGG - Intronic
944575457 2:201087136-201087158 GAAAAGAAAAAAATTCACATTGG - Intergenic
945151743 2:206798933-206798955 GAAATAACAAAAAGTCACATAGG + Intergenic
945725310 2:213467093-213467115 GGGAGCACAGAAATCCAAATGGG - Intronic
946607005 2:221416429-221416451 GAGTGCAGAAAAATAGACATTGG + Intergenic
1171362924 20:24602639-24602661 GAGAGGACAATAATTCAGAAGGG - Intronic
1171522691 20:25787622-25787644 GAGAGCAGAAAATTCCACTTCGG - Intronic
1171554136 20:26068261-26068283 GAGAGCAGAAAATTCCACTTCGG + Intergenic
1171802870 20:29642784-29642806 TAGAGAACAAATATTCAAATTGG - Intergenic
1177260896 21:18728188-18728210 AAGAGCCCAAAAATATACATTGG + Intergenic
1177556793 21:22701258-22701280 GAGAGTAGAATAATACACATTGG - Intergenic
1178452489 21:32715986-32716008 GTGAGCACATGCATTCACATTGG - Intronic
1180236798 21:46466011-46466033 GAAAGCACAAATATTATCATTGG - Intronic
1181135905 22:20766189-20766211 GAGAGCACAAGAACTCTCATGGG + Intronic
1181463271 22:23097617-23097639 GAGAGCACACAGATACACACTGG - Intronic
949821618 3:8122201-8122223 TAGAGAATAAAAATTGACATTGG + Intergenic
955260967 3:57390134-57390156 GAGAGCACCAATATTGACTTAGG + Intronic
955486718 3:59441741-59441763 GAGAGCACAAATATCAATATAGG + Intergenic
955636594 3:61036754-61036776 GTGAGCACAATAAATCACACTGG + Intronic
957877457 3:86166598-86166620 CCGAGCACAAAATTTCAAATGGG - Intergenic
958672890 3:97227695-97227717 GAAAGCAGAAACATGCACATGGG + Intronic
962742080 3:138369366-138369388 GAGAGCACAAACCTCCTCATGGG - Intronic
965723743 3:171690576-171690598 GATAAAACAAAAATTCACAAGGG - Intronic
965937879 3:174137505-174137527 GAGAGCACTAAAATCTACTTTGG + Intronic
969004086 4:4005401-4005423 CACAGCACCAAATTTCACATGGG + Intergenic
969809821 4:9639314-9639336 CACAGCACCAAATTTCACATGGG - Intergenic
970322558 4:14889305-14889327 GAGATCACAAAAACTCATAAAGG - Intergenic
970751994 4:19375088-19375110 AAGAGCATAAAGATTCTCATTGG - Intergenic
971090897 4:23344383-23344405 GTGTGCACAAAAATTCAGAAAGG + Intergenic
975939317 4:79622806-79622828 GAGAGGAAAAAAAATCACAAAGG + Intergenic
976311707 4:83619787-83619809 CTGAGCACAAAAATTCATAGTGG - Intergenic
977622776 4:99155866-99155888 GAGGGAAAAAAAGTTCACATTGG + Intronic
979340804 4:119521435-119521457 GAGAGTCCAAAGGTTCACATAGG + Intronic
980480686 4:133383720-133383742 GATCACACAAAAATTCACATGGG - Intergenic
980998084 4:139800930-139800952 GAGAGAACATAAAATGACATTGG + Intronic
982683623 4:158461709-158461731 GAGGGTAAAAAAATTTACATGGG - Intronic
987433181 5:17861695-17861717 GAAAGCACATAAAGTCACAAAGG - Intergenic
988320109 5:29684059-29684081 GAGAAAGCAAAAATTCATATTGG - Intergenic
988472468 5:31552732-31552754 GAAAGAAGAAAAATACACATAGG - Intronic
988898141 5:35700616-35700638 AAAAGCACAAAAATCCACATTGG + Exonic
990036280 5:51324505-51324527 TAGAGCTCAAAAATTCAGAAGGG + Intergenic
992351635 5:75935125-75935147 TAGAGCACATAACTTCATATTGG - Intergenic
994400480 5:99273827-99273849 TATAGAACAAAAATTGACATAGG - Intergenic
996582029 5:125041715-125041737 AAGGGCAGAAAAATTCAAATTGG + Intergenic
997762637 5:136464239-136464261 GAGAGCAAGAAACTTCGCATGGG + Intergenic
997968604 5:138381705-138381727 GAGAGCAAAAAAATGTACAGTGG - Intronic
998885558 5:146690345-146690367 GAGACCAGAAAAGTTCTCATAGG - Intronic
998994304 5:147853620-147853642 GAGAAAACAATAATTCATATGGG - Intergenic
999095104 5:148970778-148970800 GATATCACAAAAATTCAACTTGG + Intronic
1000951550 5:167489380-167489402 GAGAGAACAGAAAGTAACATAGG - Intronic
1001751956 5:174137965-174137987 GAGAGCAGAGAAAGTAACATGGG + Intronic
1008382093 6:50847500-50847522 AAGAACAGAAAAATTCAGATAGG - Exonic
1008950972 6:57158928-57158950 TAGAGCATAAACATTCACCTAGG + Intronic
1010062627 6:71642095-71642117 AAGAGCACTAAAAATCACTTAGG - Intergenic
1010708365 6:79141583-79141605 GAGAGCACAAAAGTAAAAATCGG + Intergenic
1015477973 6:133674845-133674867 GAGACCACACACAGTCACATAGG + Intergenic
1016798719 6:148146377-148146399 GGAAGCACAAAAATTCACAGTGG + Intergenic
1016834695 6:148465586-148465608 GTGAGGACAAAAATACATATGGG + Intronic
1017295151 6:152785218-152785240 AACAGAACAAAAATTCACACAGG + Intergenic
1017437429 6:154429582-154429604 GTGAGCAGAAAAATGCATATTGG - Intronic
1018466478 6:164051230-164051252 GAGAGCATGAAAATGCAGATCGG + Intergenic
1019040283 6:169098228-169098250 AAGACCAAAAAAATTCACACAGG + Intergenic
1020588707 7:10106057-10106079 GACAGCACTATAATTCACCTTGG + Intergenic
1020943439 7:14569537-14569559 GATGGCACAAAAATTCACTGAGG - Intronic
1020958455 7:14772695-14772717 GGGAGGATTAAAATTCACATTGG - Intronic
1021378604 7:19939115-19939137 CAGACCACAAAAATTGAAATGGG + Intergenic
1023551078 7:41370251-41370273 GTGAGGACAAGAATTCACCTGGG - Intergenic
1023622773 7:42089621-42089643 GAGAGCAGATAAATTCCCATGGG - Intronic
1024056785 7:45664525-45664547 GAGAACACAAAGATGCACAAGGG + Intronic
1024596880 7:50946059-50946081 GAGAGCACAGAAACTCAGAATGG + Intergenic
1025283171 7:57642823-57642845 GAGAGCAGAAAATTCCACTTCGG - Intergenic
1027277428 7:76572992-76573014 GAGAGAACCAAAAACCACATAGG + Intergenic
1027475888 7:78630995-78631017 GAGACCACAAAAATAGACATGGG - Intronic
1028291629 7:89072889-89072911 GAGAGCTCAGAAATGCACCTGGG + Intronic
1028343899 7:89757080-89757102 GAGAACACATAAAATCAGATTGG + Intergenic
1029502826 7:100944238-100944260 GAGAGCACAGACATTGAAATGGG + Intergenic
1031535369 7:122927445-122927467 TAGAGCACAAAATTTCACTCTGG - Intergenic
1031601336 7:123714275-123714297 GAAAACACAAAAATTCACTTTGG + Intronic
1033017825 7:137690062-137690084 CAGAGCTCAAAATTTCCCATGGG + Intronic
1033273377 7:139952572-139952594 GAGAGAATAAAAGGTCACATGGG + Exonic
1037991759 8:23326408-23326430 GAGAGCACAAACCCACACATCGG + Intronic
1038386982 8:27157616-27157638 GTGTGCACAAAAATTTACACTGG + Intergenic
1042512363 8:69625348-69625370 GTGAGGACAAAATGTCACATGGG - Intronic
1042990891 8:74638554-74638576 GAGAGTAGATAATTTCACATAGG + Intronic
1044554794 8:93551347-93551369 TAGAGCACAAAATTTCAGATAGG + Intergenic
1045473511 8:102534420-102534442 TAGAGCACAAACAATCACACTGG - Intronic
1046593622 8:116235088-116235110 TAGAGCACGTAAATTCACATGGG + Intergenic
1047555508 8:125924939-125924961 GTGAGCACACAGACTCACATTGG - Intergenic
1049483742 8:142840539-142840561 GAGAGGACGAGAATTCACCTGGG + Intronic
1051395636 9:16617101-16617123 GAGAACACAGAAATTGATATGGG + Intronic
1051581534 9:18680975-18680997 AATAGCACAAAAATTAAAATTGG + Intronic
1052224302 9:26066343-26066365 GAGGGCTCAAAAATTCAGCTTGG + Intergenic
1052802716 9:32984991-32985013 GAGAGCACTGAAATTCAGACAGG + Intronic
1055668355 9:78574670-78574692 GAGAGGAAAAAAATTCAGAGAGG + Intergenic
1056618899 9:88193904-88193926 GAGAGCACCCAAATGCACACAGG - Intergenic
1062328914 9:136027957-136027979 GAAAAGACAAAAATTAACATCGG + Intronic
1062731938 9:138114857-138114879 GAGAGCAAAGAAATTCAGATAGG + Intronic
1203610841 Un_KI270749v1:1455-1477 TAGAGAACAAATATTCAAATTGG - Intergenic
1185829907 X:3291200-3291222 CAGAGAACAGAAACTCACATGGG + Intergenic
1185942014 X:4332408-4332430 GAGACCACAAGAAGTCACAAGGG - Intergenic
1193450495 X:81658829-81658851 GAGAGCACTTACATTAACATAGG - Intergenic
1196320046 X:114275843-114275865 GAGAGCAGAATAATAGACATTGG + Intergenic
1197079163 X:122391508-122391530 AAGAACACAAAAGTTCACTTAGG + Intergenic
1197729057 X:129794856-129794878 GAGAGCACTAAACTTGACATTGG + Exonic
1201727137 Y:17166338-17166360 GAGACCACAAGAAGTCACAAGGG - Intergenic
1202170017 Y:22033466-22033488 GAGACCAAAAACATTAACATGGG - Intergenic
1202221349 Y:22552907-22552929 GAGACCAAAAACATTAACATGGG + Intergenic
1202321766 Y:23642755-23642777 GAGACCAAAAACATTAACATGGG - Intergenic
1202549001 Y:26027301-26027323 GAGACCAAAAACATTAACATGGG + Intergenic