ID: 1093046926

View in Genome Browser
Species Human (GRCh38)
Location 12:14457435-14457457
Sequence CAGGATCAAACTGGGTATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 249}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093046926 Original CRISPR CAGGATCAAACTGGGTATGG TGG Intronic
900416960 1:2539802-2539824 CTGGGGCTAACTGGGTATGGAGG - Intergenic
900670844 1:3853805-3853827 CAGGATGAGGCTGGGTGTGGTGG + Intronic
901444816 1:9301671-9301693 CAGGAACAAAGTGGTCATGGTGG + Intronic
901514712 1:9737243-9737265 CAGGGTCAAACTGGATGGGGGGG + Intronic
903793237 1:25908762-25908784 AAGGATCAGACTGGGTGTGGTGG - Intergenic
904255344 1:29251098-29251120 CAAAAACAAGCTGGGTATGGTGG + Intronic
905167292 1:36090167-36090189 CATTTTCAATCTGGGTATGGTGG + Intronic
906373282 1:45272698-45272720 CAGGATATAACTTGGTGTGGTGG + Intronic
906641542 1:47443890-47443912 CAAGAGCAAATTGGATATGGAGG - Intergenic
907268980 1:53279541-53279563 CAGGAAGCATCTGGGTATGGAGG - Intronic
909074417 1:71036363-71036385 AAGGGAAAAACTGGGTATGGTGG + Intronic
909577048 1:77186702-77186724 CATGAACAAAGTGGCTATGGTGG + Intronic
910988306 1:93027889-93027911 CATGAACAGACTGGCTATGGTGG - Intergenic
911249472 1:95558700-95558722 CAGGAACAAACTGGGAAGTGTGG - Intergenic
911949614 1:104155457-104155479 CAAGATCAACCTGGGTAAGGTGG + Intergenic
913575673 1:120171953-120171975 CAAGATGAGGCTGGGTATGGGGG + Intronic
914384004 1:147149867-147149889 AAAGAACAAGCTGGGTATGGTGG + Intergenic
914557987 1:148787523-148787545 CAAGATGAGGCTGGGTATGGGGG + Intergenic
914614847 1:149342707-149342729 CAAGATGAGGCTGGGTATGGGGG - Intergenic
914828104 1:151150241-151150263 CAGGTTAAGACTGGGAATGGTGG - Intergenic
915162462 1:153930087-153930109 CACGAACAAACTGGGTAGGTTGG + Exonic
915587761 1:156853499-156853521 CAGGTTCAAGGTGGGCATGGGGG - Intronic
916062804 1:161112584-161112606 AAAGATGAACCTGGGTATGGTGG - Intronic
921480637 1:215661160-215661182 CAGCATCAATCTGAGTGTGGGGG + Intronic
1063044522 10:2378234-2378256 CAGAATCCAGCTGGGCATGGTGG + Intergenic
1065203899 10:23340224-23340246 CAGGTTCAGGCTGGGTGTGGTGG + Intronic
1065650307 10:27881881-27881903 AATGCTCAAACTGGGCATGGTGG + Intronic
1069050057 10:63782852-63782874 AAAGATAAAGCTGGGTATGGTGG + Intergenic
1069473039 10:68709974-68709996 AAAGATCAGACTGGGCATGGTGG + Intergenic
1070743076 10:78915200-78915222 CAGCATGAAACTGGGTGGGGTGG - Intergenic
1071032860 10:81205564-81205586 CATGAACAAAGTGGGCATGGAGG + Intergenic
1071081151 10:81812987-81813009 AAAGATCAAGCTGGGTGTGGTGG + Intergenic
1072782495 10:98259998-98260020 CAGGATCAAACTGATTGGGGTGG + Intronic
1073703511 10:105956762-105956784 CAGGAGCTAACTTGGTATGGTGG + Intergenic
1074058826 10:109946276-109946298 CAGGATGGAAGTGGGGATGGAGG - Intronic
1074598955 10:114894269-114894291 TAGGATGAAGCTGGGCATGGTGG + Intronic
1076053554 10:127353325-127353347 CAGGAGCAAAATGGGAATGGGGG + Intronic
1077763956 11:5136643-5136665 CAGAATAAAACTGGGTATTGAGG + Intergenic
1078578457 11:12520428-12520450 CAAAATCAAACTGGTTGTGGTGG + Intronic
1079191945 11:18285947-18285969 GAGGATAAAACTGGGTGTGGGGG - Intronic
1079896449 11:26125170-26125192 CAGTATCAAACTTGGTTTGAAGG + Intergenic
1080664512 11:34324061-34324083 CAAAAACTAACTGGGTATGGTGG - Intronic
1082102166 11:48181666-48181688 CAGGATCTCATTGGGCATGGTGG - Intergenic
1083892451 11:65602825-65602847 CAAGAGCAAGCTGGGTGTGGTGG + Intronic
1084058950 11:66656951-66656973 CATTGTCAAACTGGGCATGGTGG - Intronic
1084466534 11:69326343-69326365 GCGGAACAGACTGGGTATGGTGG + Intronic
1085115694 11:73929767-73929789 CAGGATGAGGCTGGGCATGGTGG + Intergenic
1085292929 11:75412922-75412944 CAAAAACTAACTGGGTATGGTGG - Intronic
1085599916 11:77846329-77846351 CAGTATCCAGCTGGGCATGGTGG + Intronic
1087435673 11:98113991-98114013 CAGCATAAAACTGGGTAAGAAGG - Intergenic
1090273307 11:125402841-125402863 CAGGAACAAACTGGCCATGAAGG - Intronic
1090432605 11:126658754-126658776 CAGAATCAAGCAGGGTCTGGCGG - Intronic
1091103583 11:132898040-132898062 CAGGAACAAAGTGGCTATGGTGG + Intronic
1091662043 12:2391526-2391548 CAGGGTCAAGCTGGGAATGCTGG + Intronic
1091879804 12:3967912-3967934 CAGGCTCTACCTGGGTGTGGTGG + Intergenic
1093046926 12:14457435-14457457 CAGGATCAAACTGGGTATGGTGG + Intronic
1093949143 12:25144571-25144593 CATGATCATAGTGGGTATGCAGG + Exonic
1094102649 12:26780087-26780109 CATGAACAAAGTGGCTATGGTGG + Intronic
1094600399 12:31903961-31903983 AAGAAACAAGCTGGGTATGGTGG - Intergenic
1096193216 12:49633289-49633311 CTGGTTCAAACTGGGGAAGGTGG - Intronic
1096551615 12:52377200-52377222 CTGGATCACACTGGGGTTGGAGG - Intergenic
1096712949 12:53471140-53471162 TAGGATGAAATTGGGCATGGCGG + Intronic
1097175633 12:57141328-57141350 CATGAACAAGCTGGCTATGGTGG - Intronic
1098557618 12:71837503-71837525 CAGAATCTAACTGGGCACGGTGG - Intergenic
1098726489 12:73974513-73974535 CAAAAACTAACTGGGTATGGTGG - Intergenic
1098748991 12:74271749-74271771 CTGGATCATACTGGATATGTAGG + Intergenic
1098807286 12:75035755-75035777 CATGAACAAAGTGGCTATGGTGG + Intergenic
1100185598 12:92135658-92135680 CAAAAACTAACTGGGTATGGTGG + Intronic
1100627813 12:96354590-96354612 GAGCATCCAACTGGGCATGGTGG + Intronic
1101980666 12:109404188-109404210 CAGGATGCAGCTGGGTGTGGTGG + Intronic
1102487999 12:113271115-113271137 CAGGAATTAGCTGGGTATGGTGG + Intronic
1102969270 12:117153333-117153355 CAGGAGCAAGGGGGGTATGGGGG + Intronic
1103121665 12:118385394-118385416 CAGTATCAGGCTGGGCATGGTGG - Intronic
1103485864 12:121282242-121282264 CAGGAACAAAGTGGGGAAGGAGG + Intronic
1103498552 12:121382110-121382132 TAGGATCAAGCTGGGCATGGTGG - Intronic
1105037215 12:132934416-132934438 CAGGAACCATCTGGGTGTGGTGG + Intronic
1106235057 13:27854256-27854278 CAGGATGAAACTGTGTGTGAGGG + Intergenic
1107140594 13:36994736-36994758 CAGGATTAAAATGGGTAGGAGGG + Intronic
1107912903 13:45122346-45122368 CAGGATCGGGCTGGGCATGGTGG + Intronic
1108190212 13:47930625-47930647 AATGAGCAAACTGGGCATGGTGG + Intergenic
1108223951 13:48268455-48268477 CAAAAACAAACTAGGTATGGTGG - Exonic
1108560347 13:51637114-51637136 CAGGTGAAAACTGGGGATGGAGG + Intronic
1108564361 13:51680447-51680469 CAGGATCATACTGGATTAGGGGG - Intronic
1109438563 13:62339074-62339096 GAGGATCAAGCTAGGCATGGTGG - Intergenic
1109519143 13:63485626-63485648 CATGAACAAACTGGCCATGGTGG + Intergenic
1113151503 13:107269008-107269030 CAGGAATAAACTGGGAGTGGTGG + Intronic
1113319582 13:109220849-109220871 CATGAACAAAGTGGCTATGGTGG - Intergenic
1114041914 14:18686589-18686611 AATGATCAAACTGAGTGTGGTGG - Intergenic
1114719704 14:24868042-24868064 CAGGAACCAGCTGGGTGTGGTGG + Intronic
1115233783 14:31188866-31188888 CAGGATGAAGTTGTGTATGGAGG - Intronic
1117127237 14:52642243-52642265 AAAAATGAAACTGGGTATGGTGG + Exonic
1117780009 14:59222583-59222605 CATGAACAAAGTGGCTATGGTGG - Intronic
1122161483 14:99787564-99787586 CAGAGTCAATCTGGGTGTGGTGG - Intronic
1124036595 15:26058646-26058668 CAAGATGAAACTGGTCATGGTGG - Intergenic
1125476856 15:40053614-40053636 CAGGATCAAACTGGGGAGATAGG - Intergenic
1126617853 15:50604283-50604305 CTGGATCAAGCAGGGTGTGGTGG + Intronic
1126625207 15:50679820-50679842 CAGGAAAAGACTGGGCATGGTGG - Intronic
1128910382 15:71508438-71508460 CAGGGCAAAACTGGGTAGGGAGG - Intronic
1129689399 15:77704932-77704954 CTGGTGCAAACTGGGCATGGTGG - Intronic
1132012114 15:98285284-98285306 CAAGATCAAACTGGGCATGGTGG - Intergenic
1132823656 16:1891342-1891364 AAGAATTACACTGGGTATGGTGG + Intergenic
1133563969 16:6975416-6975438 CAGAAATTAACTGGGTATGGTGG - Intronic
1133795927 16:9046116-9046138 CAGGGTCAGGCTGGGCATGGTGG - Intergenic
1134000316 16:10777722-10777744 CAGGATCAAGCCGGGCGTGGTGG + Intronic
1134693394 16:16205656-16205678 CAGGATCAAACAGGAAAGGGTGG - Intronic
1134978458 16:18589044-18589066 CAGGATCAAACAGGAAAGGGTGG + Intergenic
1135019266 16:18949849-18949871 CAGGGCAAAACTGGGTGTGGTGG - Intergenic
1135463865 16:22668728-22668750 TAGGCTCACACTGGGTATAGTGG - Intergenic
1135498404 16:22972669-22972691 CAGTTTCCAGCTGGGTATGGTGG + Intergenic
1135784750 16:25338854-25338876 CAGGATTGATCTGGGAATGGAGG - Intergenic
1136344529 16:29666105-29666127 GAGGGTCAACCTGGGCATGGGGG + Exonic
1139824487 16:69746294-69746316 CAGGCTCAGGCTGGGTCTGGGGG - Intronic
1141590233 16:85063557-85063579 CAAGATCAAGCTGGGGCTGGGGG - Exonic
1142628133 17:1205187-1205209 GGGGATAAAACCGGGTATGGTGG - Intronic
1142661192 17:1430650-1430672 CAGAATCAGGCTGGGTGTGGTGG - Intronic
1142701939 17:1667963-1667985 CATGATAAAGCTGGGCATGGTGG - Intronic
1142895741 17:2977455-2977477 AAGGATCAAGCTGGGCGTGGTGG + Intronic
1144273961 17:13646954-13646976 CAGTATCAGACTGGGTGTGGTGG + Intergenic
1145833572 17:27936996-27937018 CAGGTTGAAGCTGGGTATGGTGG - Intergenic
1146601259 17:34218786-34218808 CAGTCCCAAACTTGGTATGGAGG - Intergenic
1147389927 17:40102907-40102929 CAGGAGTAAACTGGGTAGTGAGG + Intergenic
1148598074 17:48872770-48872792 CAGGGACAGACTGGGCATGGTGG + Intergenic
1149986359 17:61350260-61350282 CAAGAATTAACTGGGTATGGTGG + Intronic
1150245394 17:63670849-63670871 CAGGATGAAGCTGGGGAGGGAGG + Intronic
1150253962 17:63729168-63729190 CAGGATAACACTGTGCATGGTGG - Intronic
1150817343 17:68402810-68402832 CAGGATCAGGCTGGGCAAGGTGG - Intronic
1150861210 17:68802712-68802734 CAAAAAAAAACTGGGTATGGGGG - Intergenic
1151029356 17:70718346-70718368 CAGAAACAAACTTGATATGGTGG - Intergenic
1151602566 17:75115254-75115276 CAAAACCAAGCTGGGTATGGTGG + Intronic
1153681094 18:7501654-7501676 CAGAAACAAACTGGGCATGGTGG + Intergenic
1154406898 18:14100659-14100681 CAGAATCAGAGTGGGTATGGTGG + Intronic
1155590855 18:27425514-27425536 TAGGTTCAAACTGGGGTTGGAGG - Intergenic
1155960873 18:31993722-31993744 CAGGACCAGACTGGGCATGGTGG + Intergenic
1157320552 18:46630753-46630775 CAACATCAAAGTGGGTATGGGGG + Intronic
1158989595 18:62854982-62855004 CAGGATCAGGCTGGGTGTAGGGG - Intronic
1159985659 18:74837852-74837874 CAAGATCAAACTGGGTAACATGG - Intronic
1160271714 18:77392571-77392593 CAGAGTCAAACTGGGGATGAAGG + Intergenic
1160918039 19:1507001-1507023 CAGGATCAAAGTGGGGAGGCTGG - Intronic
1162247618 19:9415563-9415585 CAGAATAAAGCTGGGAATGGTGG - Intronic
1162473291 19:10885228-10885250 CAGGTCCAGACTGGGTTTGGGGG + Intronic
1164983269 19:32630053-32630075 CAAGATGAAGCTGGGCATGGTGG - Intronic
1166815405 19:45541850-45541872 CAGGTTCAGGCTGGGTGTGGTGG - Intronic
1166982129 19:46637307-46637329 CAGGGACAGACTGTGTATGGAGG - Intergenic
1168067933 19:53929992-53930014 TAGCATCTAACTGGGGATGGAGG + Intronic
1168108749 19:54180442-54180464 CAGGAACAATCTGGTTCTGGGGG + Intronic
925340446 2:3131957-3131979 CAGGCTGGAACTGAGTATGGTGG + Intergenic
927140423 2:20126522-20126544 CAGGACCACACCTGGTATGGTGG - Intergenic
927660539 2:24989451-24989473 CATGAACAAAGTGGCTATGGTGG + Intergenic
928071333 2:28220639-28220661 AAGGATACAACTGGGTGTGGTGG + Intronic
933701529 2:85258508-85258530 CAAGATGGAACTGGGAATGGTGG + Intronic
933854601 2:86400962-86400984 CAGAAACTAACTGGGTGTGGTGG + Intergenic
935287702 2:101579894-101579916 CAGGATCCACCTGGGTGGGGTGG + Intergenic
937393905 2:121517897-121517919 AAGGAGGTAACTGGGTATGGTGG + Intronic
937852455 2:126647914-126647936 CATGAACAAACTGGCCATGGTGG - Intergenic
938464479 2:131517313-131517335 GAGGATCAAGCAGGGGATGGGGG - Intergenic
939953071 2:148498621-148498643 CTGGATCTGACTGGGGATGGTGG - Intronic
940258640 2:151758457-151758479 CAAAATTTAACTGGGTATGGTGG - Intergenic
940768133 2:157811574-157811596 CAGGAAGAAAATGGGAATGGAGG - Intronic
942134596 2:172912052-172912074 CAGAATCAGACTGGGTGTGGTGG - Intronic
943383955 2:187180269-187180291 CATGAACAAAGTGGGCATGGTGG - Intergenic
944998818 2:205325678-205325700 TAGGATGAAGCTGGGTACGGTGG - Intronic
947648180 2:231760588-231760610 CTGGTACAAACTGGGTATGCAGG - Intronic
947866098 2:233398909-233398931 GATGATAAAACTGGGCATGGTGG - Intronic
948340332 2:237245540-237245562 CATGAACAAACTGGCCATGGTGG - Intergenic
1168749677 20:273586-273608 CAGAATCAGGCTGGGCATGGTGG + Intronic
1170492802 20:16896077-16896099 CAGGGTCAAAGTGGCAATGGTGG - Intergenic
1171315971 20:24195034-24195056 CAGGAATAAAGTGGCTATGGTGG + Intergenic
1173455767 20:43200008-43200030 CAGGGTCTATCTGGGTATGGGGG - Intergenic
1174497127 20:50955455-50955477 CAGCAACATACTGGGTTTGGAGG - Intronic
1174618165 20:51852440-51852462 CAAGAGCAAGCTGGGTGTGGTGG - Intergenic
1174626669 20:51920642-51920664 CAGAATCTCACTGGGTACGGTGG - Intergenic
1178015389 21:28339892-28339914 CAGGATAACACTGGGAGTGGAGG - Intergenic
1178489908 21:33042963-33042985 CAGGATCAAGCTGCGTTTGAAGG + Intergenic
1181323246 22:22025135-22025157 CAGGGTGAAATTGGGAATGGGGG - Intergenic
1182242565 22:28928032-28928054 CAAAATCAAACTGGAGATGGTGG - Intronic
1182394462 22:30025465-30025487 CAGGAACAAGCTGGGTAGGGAGG - Intronic
1183630833 22:39031681-39031703 CAGGATCCACCTGGGGAAGGAGG - Exonic
1183634349 22:39052061-39052083 CAGGATCCACCTGGGGAAGGAGG - Exonic
949521670 3:4861119-4861141 CTGGATCTAGCTGGGTGTGGTGG - Intronic
950630967 3:14281744-14281766 CAGGAGCAAATTGGGGAGGGCGG - Intergenic
951515549 3:23555200-23555222 CAGGACCAGGCTGGGCATGGTGG - Intronic
956712109 3:72048128-72048150 AAGGATCAGGCTGGGCATGGTGG - Intergenic
962407217 3:135110544-135110566 CTGGATAAAATTGGGTATGCTGG + Intronic
962943643 3:140148072-140148094 CAGGATTAAAGTAGGGATGGAGG + Intronic
963564363 3:146909398-146909420 CAGTAACAAGCTGGGCATGGTGG + Intergenic
963939312 3:151084679-151084701 CAGCCTCAAACTGGGTTTGGAGG + Intergenic
964114938 3:153126355-153126377 CAGTAACAAGCTGGGTGTGGTGG - Intergenic
964165373 3:153698148-153698170 CAGGATATAACTGGGGATGTGGG - Intergenic
965805867 3:172541271-172541293 CAAAAACAAGCTGGGTATGGTGG - Intergenic
966896821 3:184451319-184451341 CATGAACAAACTGGAAATGGTGG - Intronic
969134041 4:5015670-5015692 GAGGAGGAAACTGGGTGTGGGGG + Intronic
971313338 4:25545892-25545914 GAGAATCAAGCTGGGCATGGTGG - Intergenic
971557152 4:28027564-28027586 CAAGTTCAAACTGGGGATGGAGG + Intergenic
972737826 4:41862976-41862998 CAAAATCAAGCTGGGCATGGTGG + Intergenic
975789488 4:77933230-77933252 CAGGTTCTAGCTGGGTGTGGTGG - Intronic
979898296 4:126188245-126188267 CATGAACAAACTGGCTATGATGG - Intergenic
982042727 4:151410935-151410957 CAGGATTAAACTGTGTAGGGTGG + Intronic
982396140 4:154918009-154918031 CAGCATCAGACTGGGCATAGTGG + Intergenic
986294629 5:6427565-6427587 CAGGCTCAAAGTGAGTTTGGAGG - Intergenic
986493411 5:8317207-8317229 CAGAAGCAAACTTGGTATGGTGG - Intergenic
987504502 5:18750659-18750681 CATGACCAAAGTGGCTATGGTGG + Intergenic
989132343 5:38119737-38119759 CAAGATCAAACTTTGTTTGGGGG + Intergenic
989805083 5:45593961-45593983 CAGGAATAGACTGGGCATGGTGG - Intronic
990299896 5:54439662-54439684 CAAAATTAAGCTGGGTATGGTGG - Intergenic
992067713 5:73122735-73122757 CAGGAACACAGTGGGTTTGGTGG - Intronic
994229657 5:97298781-97298803 CAGAAACAACCTGGGTGTGGTGG - Intergenic
994737343 5:103571636-103571658 CAGGATCAGAAAGGGTATAGTGG + Intergenic
995427620 5:112042928-112042950 CATGATCAAAGTGGCCATGGTGG - Intergenic
995903284 5:117094143-117094165 CTGGAGGAGACTGGGTATGGGGG - Intergenic
998116718 5:139543441-139543463 CAGGATCTACGTGGGTATAGAGG - Intronic
998157088 5:139793229-139793251 CAGGGTCAGGCTGGGAATGGTGG - Intergenic
998568911 5:143239763-143239785 CAGCTTGAAACTGGCTATGGTGG + Intergenic
998801749 5:145875874-145875896 CAATATCAAGCTGGGCATGGTGG + Intergenic
999081962 5:148853050-148853072 AAGGATCAGGCTGGGTGTGGTGG - Intergenic
999194349 5:149771868-149771890 CAGGATGAAATTGGCCATGGTGG - Intronic
999660145 5:153852809-153852831 CCTCATCAAACTGGGTATAGAGG - Intergenic
1000863670 5:166486706-166486728 AAGAATAAAACTGGGTGTGGTGG - Intergenic
1001859114 5:175037699-175037721 GAGGATCAGGATGGGTATGGTGG + Intergenic
1002331542 5:178444505-178444527 CAGGACAAGACTGGGTGTGGTGG + Intronic
1002511835 5:179725357-179725379 CAGGATCTCGCTGGGTCTGGTGG - Intronic
1003332173 6:5138329-5138351 CAGAAACTAACTGGGCATGGTGG + Intronic
1003338246 6:5195321-5195343 CAGTATCAGGCCGGGTATGGTGG + Intronic
1004030309 6:11861889-11861911 CAAAAACAAGCTGGGTATGGTGG + Intergenic
1004399431 6:15274783-15274805 CAGGAGAAAACTGGGAAAGGGGG - Intronic
1005380178 6:25225681-25225703 AAGAAACAAGCTGGGTATGGTGG + Intergenic
1007047115 6:38787541-38787563 CATGACGAAACTGGGTGTGGTGG + Intronic
1015976941 6:138800017-138800039 CAAGATCAAAATGGGGAGGGGGG - Intronic
1016812357 6:148273579-148273601 CAGGGTCAGGCTGGGTGTGGTGG - Intronic
1017563952 6:155664165-155664187 CAGGTCCAGACTGGGCATGGTGG + Intergenic
1017782502 6:157727066-157727088 TAGGAGAAATCTGGGTATGGTGG + Intronic
1023059958 7:36317233-36317255 TAGGCTCAAACTGGGCATGACGG - Intergenic
1024273161 7:47657513-47657535 CAGGGACAAAATGGGAATGGAGG - Intronic
1028141848 7:87282805-87282827 CATGAACAAAGTGGCTATGGTGG + Intergenic
1028539516 7:91926692-91926714 AAGAATCAAGCTGGGCATGGTGG + Intergenic
1029417422 7:100451736-100451758 CAGATTCCAACTGGGTGTGGTGG - Intergenic
1029891614 7:103935848-103935870 AAGGATCAAATTGGGAGTGGTGG - Intronic
1033064734 7:138143894-138143916 CAGGATGAAGCTGGGGATGGGGG + Intergenic
1033135495 7:138780636-138780658 CATGAACAAAGTGGCTATGGTGG - Intronic
1035630705 8:1104735-1104757 CAGGAGCAAACTGGGGAAGGAGG - Intergenic
1036721738 8:11182064-11182086 GAGGAACAAACTGGGCGTGGTGG - Intronic
1038221956 8:25617742-25617764 CAGGATTCAGCTGGGTATGGTGG + Intergenic
1038295433 8:26287639-26287661 CAGCATCAACCATGGTATGGAGG + Intergenic
1039457344 8:37716250-37716272 CAGGCACAGACTGGGCATGGAGG - Intergenic
1040989783 8:53337634-53337656 CAGGTTAAAACTGGATATGGGGG + Intergenic
1044633034 8:94297581-94297603 CATGAACAAACTGGCCATGGTGG - Intergenic
1044695740 8:94920717-94920739 CAGGAGCAAGCTGGGGGTGGAGG - Intronic
1045549898 8:103162247-103162269 CAGGCCCAAGCTGGGCATGGTGG - Intronic
1045711434 8:104989168-104989190 CATGATTCCACTGGGTATGGTGG + Intronic
1045828025 8:106424223-106424245 AAGAATCAGACTGGGTGTGGTGG - Intronic
1046075634 8:109308682-109308704 CAGGACCAGACTGGGTGCGGTGG + Intronic
1046090389 8:109496911-109496933 CAGGATTAAACTGGCCTTGGAGG - Exonic
1046508763 8:115171847-115171869 CATGATTAAACTGGGTATATGGG - Intergenic
1047422303 8:124717202-124717224 CAGCACCAGACTGGGCATGGTGG + Intronic
1047940229 8:129822234-129822256 CAGGCTCCAGCTGGGCATGGTGG + Intergenic
1049952397 9:658024-658046 CAGAATGGAACTGGGTATGGTGG - Intronic
1052227696 9:26109193-26109215 CAGGAACAAAGTGGCCATGGTGG + Intronic
1054909646 9:70442541-70442563 CAGGTTCAAACCAGGCATGGTGG + Intergenic
1055738654 9:79361592-79361614 CTGTACCAGACTGGGTATGGTGG - Intergenic
1056881406 9:90397090-90397112 AAGGATCAAAGTGGGGGTGGGGG + Intergenic
1057014286 9:91637275-91637297 CAGGAACAAACTACTTATGGTGG - Intronic
1057046928 9:91893207-91893229 CAGGCTGAAGCTGGGCATGGTGG + Intronic
1057944077 9:99309397-99309419 AAGGATCCAAATGGGGATGGGGG + Intergenic
1058649001 9:107157500-107157522 CAGGATCACTCTGGGTGTTGTGG - Intergenic
1059695130 9:116723516-116723538 CAGGATGAATCTGGGCTTGGAGG - Intronic
1059734585 9:117088500-117088522 CAGGATTAAACTGTGTGTGTTGG + Intronic
1061343873 9:130006153-130006175 CAGGTACAGGCTGGGTATGGTGG + Intronic
1186203922 X:7181796-7181818 AATGATCAAGCTGGGTGTGGTGG + Intergenic
1187213645 X:17253948-17253970 CAGGAAGAAACTGGGTGTTGGGG - Intergenic
1187777953 X:22784876-22784898 GAGGATCAAGCTTGGTATAGTGG - Intergenic
1189449013 X:41109753-41109775 TAGCATCACACTGGGGATGGGGG + Intronic
1191946465 X:66539840-66539862 CATGAACAAACTGGACATGGTGG + Intergenic
1193956828 X:87873909-87873931 GAGGAGAAAACTGTGTATGGGGG + Intergenic
1194402365 X:93454486-93454508 GAGCATCAAACTGAGTTTGGTGG + Intergenic
1194834061 X:98659619-98659641 CAGGAACAAAGTGGCCATGGTGG + Intergenic
1195612931 X:106889620-106889642 TAGGATTAGACTGGGCATGGTGG - Intronic
1197744583 X:129923209-129923231 CAGGATCAACTTGGGAATGGAGG + Intronic
1199375566 X:147104249-147104271 CAGGATCCTACTGGGCATGGTGG + Intergenic
1201333833 Y:12857686-12857708 AAGCATCAAAATGGGTTTGGGGG - Intronic
1201398965 Y:13582040-13582062 CATGAAAAAACTGGCTATGGTGG + Intergenic