ID: 1093049672

View in Genome Browser
Species Human (GRCh38)
Location 12:14490990-14491012
Sequence AGTTACCTGCAAAAGATGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 628
Summary {0: 1, 1: 4, 2: 33, 3: 248, 4: 342}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093049669_1093049672 15 Left 1093049669 12:14490952-14490974 CCTTTAACAGGCCAAGAGCTGTC 0: 2
1: 174
2: 185
3: 139
4: 214
Right 1093049672 12:14490990-14491012 AGTTACCTGCAAAAGATGACAGG 0: 1
1: 4
2: 33
3: 248
4: 342
1093049667_1093049672 17 Left 1093049667 12:14490950-14490972 CCCCTTTAACAGGCCAAGAGCTG 0: 1
1: 1
2: 3
3: 14
4: 145
Right 1093049672 12:14490990-14491012 AGTTACCTGCAAAAGATGACAGG 0: 1
1: 4
2: 33
3: 248
4: 342
1093049671_1093049672 4 Left 1093049671 12:14490963-14490985 CCAAGAGCTGTCTCTCAAAAGGA 0: 181
1: 197
2: 163
3: 130
4: 293
Right 1093049672 12:14490990-14491012 AGTTACCTGCAAAAGATGACAGG 0: 1
1: 4
2: 33
3: 248
4: 342
1093049666_1093049672 23 Left 1093049666 12:14490944-14490966 CCAAAGCCCCTTTAACAGGCCAA 0: 1
1: 0
2: 13
3: 9
4: 124
Right 1093049672 12:14490990-14491012 AGTTACCTGCAAAAGATGACAGG 0: 1
1: 4
2: 33
3: 248
4: 342
1093049668_1093049672 16 Left 1093049668 12:14490951-14490973 CCCTTTAACAGGCCAAGAGCTGT 0: 1
1: 5
2: 190
3: 204
4: 279
Right 1093049672 12:14490990-14491012 AGTTACCTGCAAAAGATGACAGG 0: 1
1: 4
2: 33
3: 248
4: 342
1093049665_1093049672 26 Left 1093049665 12:14490941-14490963 CCACCAAAGCCCCTTTAACAGGC 0: 1
1: 0
2: 7
3: 16
4: 196
Right 1093049672 12:14490990-14491012 AGTTACCTGCAAAAGATGACAGG 0: 1
1: 4
2: 33
3: 248
4: 342

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093049672 Original CRISPR AGTTACCTGCAAAAGATGAC AGG Intronic
900434958 1:2625576-2625598 AGTTAACTGCAGAAGATAGCAGG - Intronic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
903713075 1:25340472-25340494 AGTGACCTGAAAAAAATGTCTGG + Exonic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905846088 1:41233915-41233937 AGTAACCTGTGAAAGATCACAGG - Intronic
906721602 1:48009696-48009718 AGTGACCTCCCAAAGATTACAGG - Intergenic
907597345 1:55732128-55732150 AGTTATCTGCAGAAGATGACAGG - Intergenic
907883827 1:58575846-58575868 AGTTACTTGCAAACGATCCCGGG + Exonic
907933305 1:59019768-59019790 AGTTACCAGCAAGAGATGCAGGG + Intergenic
909073293 1:71022946-71022968 AGTTAACTATAAAAGAGGACAGG - Intronic
909172609 1:72315466-72315488 AATTATCTGCAGAAGATGGCAGG + Intergenic
909294368 1:73928090-73928112 AGTCACCTGGAAAAGAGCACAGG + Intergenic
909571140 1:77112092-77112114 AGTTACCCACCAAACATGACTGG + Intronic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
910561899 1:88599979-88600001 GGTTATCTGCAGAAGATGGCAGG - Intergenic
910588215 1:88901724-88901746 AATTATCTGCAGAAGATGGCAGG - Intergenic
910630219 1:89346250-89346272 AGTTATCTGCAAAAGATGGCAGG - Intergenic
910831099 1:91463426-91463448 AGTTGTCTGCAAAAGATGGCAGG + Intergenic
910948213 1:92616686-92616708 AGTTATCTGAAGAAGATGGCAGG - Intronic
911109099 1:94164207-94164229 AGTTATCTTCAGAAGATGGCAGG + Intronic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
911981900 1:104579264-104579286 AGTTATCTGCAAAGTATGGCAGG + Intergenic
912126303 1:106543037-106543059 AGTTAGCTGCAAAAGAGCAGGGG - Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912733324 1:112128831-112128853 AGTCATCTGCAGAAGATGGCAGG + Intergenic
914946199 1:152068781-152068803 TGTTGTCTGCAAAAGATGTCAGG - Intergenic
916106331 1:161435329-161435351 AGTTATTTGCAGAAGATGGCAGG + Intergenic
917018904 1:170564704-170564726 AGTGACCTGCAAATAATGATGGG - Intergenic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
917333247 1:173904107-173904129 ATTTACCTGCCAAAAATGAACGG - Intronic
918815077 1:189171226-189171248 AGTTACCTGCAGAAGATGGCTGG - Intergenic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
919124613 1:193379783-193379805 AGTTATCTACAGAAGATGGCAGG + Intergenic
919174822 1:194005867-194005889 ATTTGCTTGCAAAATATGACTGG - Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
920197429 1:204238364-204238386 AGTTAGCTGCAGAAGATGGCAGG - Intronic
921607495 1:217172987-217173009 TGATATCTGCAAAAGAAGACAGG - Intergenic
922781048 1:228252583-228252605 AGTTATCTGCAGAAGATGACAGG + Intronic
923148681 1:231215358-231215380 GGTGACCTGGAAAAGAAGACAGG - Exonic
923253570 1:232199439-232199461 AGTTATCTGCAGAAGATAGCAGG + Intergenic
924836529 1:247653690-247653712 AGATAACAGCAAAATATGACTGG - Intergenic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1062804837 10:410481-410503 ATTTTCCTGGAAAAGATCACTGG + Intronic
1064517644 10:16168258-16168280 AGTTATCTGCAGAAGAGGGCAGG + Intergenic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1065440339 10:25747158-25747180 AGTTTCCTGTGAAAGATGAGTGG - Intergenic
1065910505 10:30299596-30299618 ATAGACCTGCACAAGATGACAGG - Intergenic
1066333250 10:34448087-34448109 AGTGACCTGCAACCGATGAATGG + Intronic
1066957621 10:42188051-42188073 AGTTAACTGGAGAAGATGACCGG - Intergenic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1067712406 10:48659365-48659387 AGTCACCTGGAAGAGAAGACTGG + Intergenic
1068007719 10:51409878-51409900 AGTTATCTGCAGAAGATGTCAGG + Intronic
1068447208 10:57138591-57138613 AGTTATCTGAAGAAGATGGCAGG - Intergenic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069851869 10:71410650-71410672 AGTTAACTTCAGAGGATGACGGG - Intronic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071937687 10:90549274-90549296 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1072655563 10:97327855-97327877 AGTTACCTGCCCAAGGTCACAGG - Intergenic
1073656681 10:105424485-105424507 AGTTATCTGCAGAAGATGTCAGG + Intergenic
1073858532 10:107707617-107707639 AGTTACCTGGAAAAGAACAGAGG - Intergenic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073957686 10:108891655-108891677 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1074177965 10:111030093-111030115 AGGTACCAGCAAATGCTGACGGG - Intergenic
1076197327 10:128528500-128528522 AGTTACCAGCAAGAGAGCACTGG - Intergenic
1076772631 10:132674841-132674863 AGTTACCTGCAGAAGATGGCAGG + Intronic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1077203344 11:1325627-1325649 AGATAGCTGGAAAAGATGACTGG + Intergenic
1080076590 11:28157493-28157515 AGTTATCTGCAGAAGATGTCAGG - Intronic
1080095369 11:28399428-28399450 AGTTTTCTGCAAAGGATGAAAGG - Intergenic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1081110475 11:39128391-39128413 AGTTATCTGCATAAGATGGCAGG - Intergenic
1081609059 11:44547850-44547872 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1085685960 11:78622162-78622184 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1085747569 11:79128212-79128234 AGTTATCTGCAGAAGATGCCAGG - Intronic
1086282873 11:85210927-85210949 AGATACCTGTGAAAGATGAAGGG - Intronic
1086356126 11:86001656-86001678 AGGTTCCTTCAAAAGAAGACTGG + Intronic
1087153256 11:94877520-94877542 AGTAATGTGCAAAAGATGGCAGG + Intergenic
1088191662 11:107234518-107234540 AGTTATCTGCAGAATATGGCAGG + Intergenic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1089207206 11:116773682-116773704 AGTTTCCTTCAAGAGATAACTGG - Intergenic
1090209495 11:124908075-124908097 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093031873 12:14295977-14295999 AGTTATCTGCGGAAGATGGCAGG + Intergenic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093048926 12:14484995-14485017 AGTTACCTGCAAAAGATGGCAGG + Intronic
1093049672 12:14490990-14491012 AGTTACCTGCAAAAGATGACAGG + Intronic
1093392086 12:18635562-18635584 GGTTATCTGCATAAGATGGCAGG + Intronic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1093964536 12:25310929-25310951 AGTTATCTGCAGAAGACGGCAGG - Intergenic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1095289372 12:40459765-40459787 AGTGTCCAGCAACAGATGACTGG - Intronic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096173055 12:49489448-49489470 ATTTATCTGGAAAAGATGACAGG - Exonic
1096288710 12:50322933-50322955 AGTTATCTACAGAAGATGGCAGG - Intergenic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1096982566 12:55736886-55736908 AGATACCTGCCAAAGAAGAAGGG + Intergenic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097620983 12:61939301-61939323 AGTTGCCTAGAAAATATGACTGG + Intronic
1097821385 12:64132191-64132213 AGTTATCTGCAGAAGAAGGCAGG + Intronic
1098102304 12:67030903-67030925 AGTTGCTTGAAAAAAATGACAGG - Intergenic
1098195889 12:68001905-68001927 AGCTACCTGCAAATGAGGATAGG + Intergenic
1098673038 12:73254217-73254239 AGTTAACTGCAGAAGATGGCAGG - Intergenic
1098731049 12:74037321-74037343 AGTTATCTGCAGAAGATAGCAGG - Intergenic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1098749845 12:74279564-74279586 AGTTATCTGCAGAAGATGACAGG - Intergenic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099365921 12:81765357-81765379 AGTTATCTGCAGAATATGGCAGG - Intergenic
1099375646 12:81893930-81893952 AGTAATCTGCAGAAGATGGCAGG - Intergenic
1099477049 12:83121134-83121156 ATTTACCTGCAAAAGAATTCAGG - Intronic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1100045035 12:90369453-90369475 AGTGCCCATCAAAAGATGACTGG + Intergenic
1100083302 12:90878185-90878207 AGTTATCTGCAGAAGATGTCAGG - Intergenic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101264129 12:103066095-103066117 AGTTATCTGCAGAAGATGACAGG - Intergenic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1103396526 12:120611420-120611442 AGTTACCTGCAGAACATGTCAGG - Intergenic
1105740106 13:23315149-23315171 AGTTATCTTCAGAAGATGGCAGG - Intronic
1106634204 13:31509590-31509612 TGTTATCTGCAAAAGATGCTTGG - Intergenic
1107983578 13:45755999-45756021 AGTTATCTGCAGAAGATGACAGG + Intergenic
1108193700 13:47970430-47970452 AGTTACGTGAAGATGATGACTGG - Intronic
1108904275 13:55449944-55449966 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1109951026 13:69502232-69502254 AGTTATCTGCAGAAGATAGCAGG + Intergenic
1110834138 13:80064656-80064678 TGTTATCTGCAGAAGATGGCAGG + Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1112127776 13:96487880-96487902 AATTACCTTCAAAATGTGACTGG + Intronic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1112247859 13:97750636-97750658 AAGTCCCTGGAAAAGATGACGGG - Intergenic
1112249931 13:97770305-97770327 AATTATCTGCAGAAGATGGCAGG + Intergenic
1113319708 13:109221690-109221712 CGTTATCTGCAGAAGATGGCAGG + Intergenic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1114788617 14:25629712-25629734 AAGTACCTGCAACAGAAGACAGG + Intergenic
1115059714 14:29173867-29173889 AGTTATCTGCAGAAGATGACAGG - Intergenic
1115143396 14:30199360-30199382 AGTTATCTCCAGAAGATAACAGG - Intergenic
1115997027 14:39204846-39204868 ATTTACCTGAAAAAGAATACAGG + Intergenic
1116158382 14:41236692-41236714 AGCTATCTGCAGAAGGTGACAGG + Intergenic
1116308048 14:43283474-43283496 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1116415069 14:44669285-44669307 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1117001597 14:51376285-51376307 AGTTATCTGCAGAAGATCACAGG - Intergenic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1118122436 14:62860197-62860219 AGTTATCTGCAGAAGACGGCAGG + Intronic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1119107566 14:71938866-71938888 AGTTACCTGCAGAAGATGACAGG + Intronic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1120169404 14:81233959-81233981 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1120231424 14:81845278-81845300 AGTTATCTGCAGAAGATAGCAGG + Intergenic
1120250743 14:82059676-82059698 AATTATCTGCAAATGATGGCAGG + Intergenic
1120555997 14:85930472-85930494 AGTTATCTGCATAAGATGGCAGG + Intergenic
1126283607 15:46986250-46986272 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1129903555 15:79170168-79170190 AGTTACCAGCCCAAGATCACAGG - Intergenic
1131300578 15:91196345-91196367 AGTTACATGGAAAAGGTGACAGG + Intronic
1131616917 15:94025896-94025918 AGTTACCTCCAAATCATGACTGG - Intergenic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1133892035 16:9888418-9888440 AATTACCTGAAATAGATTACAGG - Intronic
1134598641 16:15515782-15515804 AGTAACCTGCCCAAGCTGACAGG - Intronic
1134831374 16:17326357-17326379 AGTTACTTGCCCAAGATCACAGG - Intronic
1134891732 16:17847028-17847050 AGTTGCATGGAGAAGATGACAGG - Intergenic
1135475787 16:22773416-22773438 AGTGTCCTTCAATAGATGACTGG + Intergenic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1138647906 16:58438595-58438617 GGTTTGCTGCAAAAGATGAAGGG + Intergenic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1140493198 16:75358640-75358662 TTTTACCTGAAAAAAATGACTGG + Intronic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1143050118 17:4118377-4118399 AGTTATCTGCAAAAGATAGTAGG + Intronic
1143856059 17:9850496-9850518 AGTCACCTTCAATCGATGACTGG + Intronic
1144845867 17:18218708-18218730 AGTGACCTGCCCAAGGTGACAGG - Intergenic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1146836352 17:36113973-36113995 AGTTATCTGAACAAGATGGCAGG - Intergenic
1148044007 17:44731302-44731324 AGTTACTTGTAAAAGAAGTCTGG - Intronic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1152562280 17:81084589-81084611 AGTTCCCTCCCAAAGATGCCAGG + Intronic
1153089704 18:1330131-1330153 AGTTAACTGCAGAAGATGGCAGG - Intergenic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1154068461 18:11131068-11131090 AGTTATCTGCAGAAGGTGGCAGG - Intronic
1154206453 18:12341231-12341253 ACTTAATTGCAAAAGAGGACTGG - Intronic
1154252674 18:12757306-12757328 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156606368 18:38671734-38671756 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1156712968 18:39969393-39969415 AGTTTCCTCCATAAGATGAATGG + Intergenic
1156990307 18:43400806-43400828 AGTTATCTGCAGAAGACGGCAGG + Intergenic
1157226607 18:45871530-45871552 AGTGTCCTTCAAAAGATGAATGG + Intronic
1157341198 18:46779996-46780018 AGTTATCTGGAGAAGATGGCAGG - Intergenic
1157998507 18:52588155-52588177 AGTTATCTGCAGAAGATGGAAGG + Intronic
1158199316 18:54922528-54922550 AGTTACTAGGAAAAGATGACTGG + Intronic
1159287787 18:66375451-66375473 AGTTATCTGCAGAAGATAGCAGG - Intergenic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1164097089 19:22021374-22021396 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1164117261 19:22234605-22234627 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
926541523 2:14185845-14185867 ATTTAGCTGCAAAAGAGGCCAGG - Intergenic
926825569 2:16902261-16902283 GGTTATCTGCAGAAGATGGCAGG + Intergenic
927008714 2:18879693-18879715 ACTTATCTGCAGAAGATGGCAGG - Intergenic
927686782 2:25176756-25176778 GGTTACCTGCATAATAAGACAGG + Intergenic
928092124 2:28381420-28381442 ACTTACCTGCACAAGAAGACAGG - Intergenic
928733839 2:34262395-34262417 ATTTACCTGCAAAAGAATTCAGG + Intergenic
928801448 2:35098912-35098934 AGTTACCTGCAATTCATGATAGG + Intergenic
930295407 2:49547540-49547562 AGTTACCTGCAGAAGATGGCAGG + Intergenic
930446589 2:51481344-51481366 AGTTATCTGCCAATGAAGACAGG - Intergenic
930611137 2:53545145-53545167 AGTTAACTCCAAAAGACCACCGG + Intronic
930910148 2:56620868-56620890 AGTTATCTGCAGAAGATGCCAGG - Intergenic
931266685 2:60666752-60666774 AGTTGCCTGAAAAAAATGGCTGG - Intergenic
932632159 2:73354226-73354248 AGTCACCTTCAAAGGATGATAGG - Intergenic
933265687 2:80178412-80178434 AGTTATCTGCAGAAGATGACAGG + Intronic
934305739 2:91820565-91820587 AGTTAACTGGAGAAGATGACCGG - Intergenic
934327517 2:92032177-92032199 AGTTAACTGGAGAAGATGACCGG + Intergenic
934465906 2:94262756-94262778 AGTTAACTGGAGAAGATGACCGG + Intergenic
935425113 2:102911356-102911378 AGTTATTTGCAGAAGATGGCAGG + Intergenic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
935946639 2:108292860-108292882 AGTTTCCATCAATAGATGACTGG + Intronic
937582066 2:123499196-123499218 AGTTCTCTGCAGAAGAAGACAGG + Intergenic
937785210 2:125887757-125887779 AGTTATCTGCAGAGGATGGCAGG + Intergenic
937852573 2:126648767-126648789 AGCTATCTGCAGGAGATGACAGG + Intergenic
938897104 2:135763306-135763328 AATACCCTGCAAAAGATGGCAGG - Intronic
938917084 2:135952761-135952783 AGTTTCCTTCAACAGATGAATGG - Intronic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939633368 2:144551812-144551834 AGTTATCTGCAGATGATGGCAGG + Intergenic
939788688 2:146546142-146546164 AGTTATCTGCAGAAGATGCCAGG + Intergenic
939798056 2:146672409-146672431 GGTAACCTTCAAAAGATGAATGG + Intergenic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
940171315 2:150832741-150832763 AGTTATCTGCAGAAGTTGATAGG + Intergenic
940460353 2:153957171-153957193 AGTTACCTACACAAGACAACTGG + Intronic
940599112 2:155835136-155835158 AAATACCTGCAAAAGAGGAAGGG + Intergenic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
941885582 2:170524007-170524029 AGGTACCAGGAAAAGATGAAGGG + Intronic
942987905 2:182163965-182163987 AGTTATCTGCAGATGATGCCAGG - Intronic
943006893 2:182395812-182395834 AGTTATCTGGAGAAGATGGCAGG - Intronic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943354755 2:186838953-186838975 CATCACCTGCAAAAGGTGACAGG + Exonic
943388126 2:187227107-187227129 AGTTATCTGCAGAAGATGGTAGG - Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
944205763 2:197156702-197156724 AGTTTCCATCAAAAGATGAATGG + Intronic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945648741 2:212535491-212535513 AGTTACCTGCAAAAAAGAAATGG + Intronic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
946790918 2:223299731-223299753 AGTTATCTGCAAATGATGGCAGG - Intergenic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1170092312 20:12604140-12604162 AGGTATCTGCAGAGGATGACAGG + Intergenic
1171324578 20:24280333-24280355 AGTGACCTGCATAAGACAACTGG + Intergenic
1172705963 20:36882074-36882096 AGTGACAGGCACAAGATGACTGG + Intronic
1175858236 20:62134146-62134168 AGGAGCCTGCAAGAGATGACAGG - Exonic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1176998157 21:15580155-15580177 AGTTATCTGCAGAAGACGGCAGG - Intergenic
1177505564 21:22014211-22014233 AGTTATCTGCAGAAGATGGAAGG + Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178012657 21:28305146-28305168 AGTTATCAGCAGAAGATGGCAGG - Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178620569 21:34170506-34170528 AATTGCTTGCAAAAAATGACTGG - Intergenic
1179137036 21:38688590-38688612 AATTACCTCCAAAAGATGTAGGG + Intergenic
1179415153 21:41192550-41192572 AGTTATCTGAAGAAGATGGCAGG + Intronic
1180279825 22:10683393-10683415 AGTTAACTGGAGAACATGACCGG + Intergenic
1180587041 22:16901929-16901951 AGTTAACTGGAGAAGATGACCGG + Intergenic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1181367439 22:22388973-22388995 AGCTACCTGCAGAAGATGGCAGG + Intergenic
1182856882 22:33525463-33525485 AGTGACATGCAACAGAAGACAGG - Intronic
1183297009 22:37035996-37036018 AGTGACTTGCCCAAGATGACAGG + Intergenic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949245863 3:1924893-1924915 AGTTATCTGCAGAAGGTGGCGGG - Intergenic
949395699 3:3612920-3612942 AATGACCTGCCAAAGAGGACAGG + Intergenic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
949638777 3:6012487-6012509 AGTTATCTGCAAAAGATGGCAGG - Intergenic
951003616 3:17592822-17592844 AGTTATCTACAGAAGATGGCAGG - Intronic
951085259 3:18505249-18505271 AATTACCTGACAAAGATGCCAGG - Intergenic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951967231 3:28399938-28399960 ATTTACCTGAAAAAGAATACAGG + Intronic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
952605448 3:35142045-35142067 ATTTATCTGCAGAAGATGGCAGG + Intergenic
953178457 3:40574019-40574041 AGGTAACTCTAAAAGATGACGGG + Intronic
953585875 3:44200497-44200519 AGCTACAAGCAGAAGATGACAGG + Intergenic
954054115 3:48007647-48007669 AGTTATCTGTAGAAGATGGCAGG - Intronic
954363312 3:50133748-50133770 AGTTACCTGCAGATGAGGACTGG - Intergenic
954416020 3:50393736-50393758 AGTGACCTGCAAGAGATGCTGGG - Intronic
955035581 3:55264062-55264084 AGTTATCTGCAGAGGATGGCAGG - Intergenic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956360449 3:68441408-68441430 AGTAATCTGCAGAAGATGGCAGG - Intronic
956417625 3:69050457-69050479 AAATACATTCAAAAGATGACAGG + Intronic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956703897 3:71982917-71982939 AGTTATCTGCAGAAGATGACAGG + Intergenic
957163151 3:76636341-76636363 AGTTTACAGCTAAAGATGACAGG - Intronic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
958014421 3:87921919-87921941 AGTTTCCATCAAAAGATGAATGG - Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959439506 3:106359152-106359174 AGTTATCTGCAGAAGACGGCAGG - Intergenic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959997856 3:112698292-112698314 AGTTATCTGCAGAAGATGGAAGG - Intergenic
960508015 3:118516542-118516564 AATTAGCTGCAAATGATGGCAGG + Intergenic
960701310 3:120442117-120442139 AAATACCTGCAAGAGATGAAGGG - Intronic
961262845 3:125616393-125616415 AGTTATCTGCAGAAGATGGTAGG - Intergenic
963565024 3:146918797-146918819 AGTTTCCTGGAAAAGAAGATTGG + Intergenic
963630307 3:147723190-147723212 AGTTATCTGCAGAAGATTACAGG - Intergenic
963661389 3:148132115-148132137 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
964294494 3:155218691-155218713 AGTGTCCAGCAAAAGAAGACAGG - Intergenic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
965226770 3:166000794-166000816 AGTTATCTGCAGAAGATGGTAGG + Intergenic
965251334 3:166348297-166348319 AGTTATCTGCAGAAGATTCCAGG + Intergenic
965291744 3:166889610-166889632 AGTTATATGCAGAAGATGGCAGG + Intergenic
965301289 3:167008354-167008376 AATTAACTGCATTAGATGACTGG + Intergenic
965708648 3:171534809-171534831 AGTTATCTGCAGAGGATGGCAGG + Intergenic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
966623848 3:181995323-181995345 ATTTACCTGAAAAAGAAGTCAGG + Intergenic
966661310 3:182417979-182418001 AGTTATCTGCAAATGATGGCAGG - Intergenic
967156342 3:186695977-186695999 ACTTACCTACAACAAATGACAGG + Intergenic
967162710 3:186753324-186753346 AGTTCCCTGCAAAGGAGGAAAGG - Intergenic
967401761 3:189070799-189070821 AATTACCTGAAAAACATGGCAGG + Intronic
968800180 4:2738091-2738113 AGTTAGCTGCAGAAGATGGCAGG - Intergenic
968906942 4:3457937-3457959 AGTTATCTGCGGAAGATGGCAGG - Intergenic
970323273 4:14896848-14896870 AGATACCTGCAAAACCTGAATGG - Intergenic
970834383 4:20384267-20384289 AGCTAGCTGCAAAAGATCCCAGG + Intronic
971101014 4:23466452-23466474 AGTTATCTGCAGAAGATAGCAGG + Intergenic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
971857654 4:32062863-32062885 AGTTATCTGCAGAAGATGACAGG + Intergenic
971979298 4:33732903-33732925 AGTTACCTGCAGAAGATGGCAGG + Intergenic
972095490 4:35342661-35342683 AGTTACTTGCAGAAGACGGCAGG - Intergenic
972114322 4:35610151-35610173 AGTTTCCATCAAAAGATGAATGG + Intergenic
972201301 4:36717183-36717205 AGTTATCTGTAGAAGATGGCAGG + Intergenic
972805913 4:42529297-42529319 AGTTACCTGCAGATTATGGCAGG - Intronic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
973533706 4:51859341-51859363 AGTCACTTGCAAAATATAACTGG - Intronic
974262374 4:59542299-59542321 AGTTATCTGCAGAAGATGGTAGG + Intergenic
974289565 4:59912712-59912734 AGTTAACTGTAGAAGATGGCAGG - Intergenic
974564786 4:63568283-63568305 AGTTATCTCCAGAAGATGGCAGG - Intergenic
974746917 4:66088935-66088957 AGTTATCTTCAGAAGATGGCAGG + Intergenic
974882554 4:67777858-67777880 AGTTATCTGAAAAAGAGGTCTGG + Intergenic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
975386719 4:73767539-73767561 AGTTATCTACAGAAGATGGCAGG + Intergenic
976034208 4:80795851-80795873 AGTTATTTGCAGAAGATGGCAGG + Intronic
977031619 4:91891377-91891399 AGTTATCTACAGAAGATGGCAGG - Intergenic
977204714 4:94155654-94155676 AGTTATCTGCAGAAGATGACAGG - Intergenic
977430763 4:96928182-96928204 AGGTATCTGCAGAAGATGGCAGG - Intergenic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
978465639 4:109005776-109005798 AACTAGCTGCAAAAGAAGACAGG + Intronic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
978966848 4:114750914-114750936 AATTATCTGCAGAAGATGGCAGG - Intergenic
978999314 4:115198718-115198740 ATTTACCTGAAAAAGAATACAGG - Intergenic
979704948 4:123709888-123709910 ATTTACCTGAAAAAGAAGTCAGG + Intergenic
979767017 4:124474565-124474587 AGTTATCTGTAGAAGATGGCAGG - Intergenic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980387950 4:132111211-132111233 AGTTATCTGCAGAATATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980497528 4:133605392-133605414 AGTTATCTACAGAAGATTACAGG + Intergenic
980629520 4:135414256-135414278 AGTTATATGCAGAAGATGGCAGG - Intergenic
980630932 4:135432231-135432253 AGTGCCCATCAAAAGATGACTGG + Intergenic
980957729 4:139445887-139445909 AGTTATCTGCAGAAGATGTCAGG - Intergenic
981014088 4:139955409-139955431 GGTTTCTTCCAAAAGATGACTGG - Intronic
981115815 4:140989950-140989972 ACTTACCTGCATAAAAAGACTGG + Intronic
981462808 4:145031775-145031797 AGTTATTTGCAAAAGATGGCAGG - Intronic
981873532 4:149515163-149515185 AGTTATCTCCAAAAGATGGCAGG - Intergenic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
982623345 4:157732931-157732953 GGTTATCTGCAGAAGATGGCAGG + Intergenic
982786160 4:159539307-159539329 AGTAACCTGGAAAAGGTGGCTGG - Intergenic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983731083 4:170994246-170994268 AGTTTCCATCAAAAGATGATTGG + Intergenic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
986938334 5:12918780-12918802 AGTTACCTGAAGAAGATGGCAGG + Intergenic
986959836 5:13199189-13199211 AGTTAACTGCAGAAGATGGCAGG - Intergenic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987257590 5:16172355-16172377 AGTTACCTACAAAATATGCCAGG + Intronic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
987504385 5:18749824-18749846 AGTTAACTACAGAAGATGACAGG - Intergenic
987657141 5:20821681-20821703 AGTTATTTGCAAAAGATGGCAGG + Intergenic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
988188771 5:27901207-27901229 GGTTATCTGCAGAAGATGGCAGG - Intergenic
988258173 5:28848511-28848533 AGTTACGTGCAGATAATGACAGG - Intergenic
988562127 5:32290818-32290840 CGTTATCTGCAGAAGATGGCAGG - Intronic
988766410 5:34382267-34382289 AGTTATCTGCAAAAGATGGCAGG - Intergenic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989160928 5:38390908-38390930 AGATACCTGCAACACATGATTGG - Intronic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
989486387 5:41996388-41996410 AGTTATCTGCAAAAGATGGCAGG + Intergenic
990007126 5:50956631-50956653 AGTAACTTGCACAAGATTACAGG + Intergenic
990817245 5:59799265-59799287 AGTTAACTGCAGAGAATGACTGG + Intronic
991013809 5:61910929-61910951 AGTTATCTGCAGAAGATAGCAGG + Intergenic
991033542 5:62105893-62105915 AGTTATCTGCAGAAAATGGCAGG - Intergenic
991352664 5:65734634-65734656 AGATACCAGCAAAATATGGCTGG - Intronic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992109883 5:73482906-73482928 AGTTATCTGCAGAAGATGACAGG + Intergenic
992242936 5:74789722-74789744 AGTTATCTGAAGAAGATGGCAGG - Intronic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
993087523 5:83381870-83381892 ACTTACCTGCAAAAGAGGGTGGG - Intergenic
993231904 5:85247562-85247584 AGTTTTCTGCAAAAGATGGCAGG + Intergenic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993412585 5:87591841-87591863 AGTTATCTGCAGAAGATGGTAGG + Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
993791788 5:92218882-92218904 ATTTATCTGCAGAAGATGGCAGG - Intergenic
994317673 5:98351466-98351488 AATTAACAACAAAAGATGACAGG + Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
995427736 5:112043755-112043777 AGTTATTTGCAGAAGATGGCAGG + Intergenic
995500520 5:112800143-112800165 AGTTACTTGCAATAGATGCTGGG - Intronic
995616379 5:113968982-113969004 AGACACCTGCAAAAGATGAGAGG - Intergenic
996018556 5:118567827-118567849 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
996164958 5:120212537-120212559 AGTTATCTGCAGAAGATCTCAGG + Intergenic
996392205 5:122973814-122973836 AGTTATCTGCAGATGATGGCAGG + Intronic
996594798 5:125187962-125187984 AGTTTTTGGCAAAAGATGACTGG + Intergenic
996825560 5:127677806-127677828 AATTATCTGCAGAAGATGGCAGG - Intergenic
998290339 5:140908580-140908602 AGTTAGCTGCAGAAGATGGAAGG + Intronic
998765469 5:145482092-145482114 AGTTATGTGATAAAGATGACAGG - Intronic
999530638 5:152459515-152459537 ACTTAGCTGCAAAAGAGGAATGG - Intergenic
999934789 5:156475066-156475088 ATTAACCTGCAAAATATGCCAGG + Intronic
999990577 5:157046366-157046388 AGTTAGCTGGGAAAGATGACAGG + Intronic
1000223249 5:159234277-159234299 AGGTATCTGCAGAAGATGGCAGG + Intergenic
1000416970 5:160993873-160993895 AGTTATCTACAGAAGATGGCAGG - Intergenic
1000621622 5:163492964-163492986 AGTTATCTGCATAGGATAACAGG + Intergenic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1003275876 6:4652507-4652529 AGTTTCCTTCAATAGATGAATGG + Intergenic
1003695901 6:8406168-8406190 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1004013818 6:11714063-11714085 AGTTACCTGCAAAAGGCAAAAGG - Intronic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1005859875 6:29892127-29892149 AGTGACCTGCAAAAGATAGAGGG + Intergenic
1005867459 6:29946911-29946933 AGTGACCTGCAAAAGATAGAGGG + Intergenic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1007306741 6:40912657-40912679 ATCTACCTGCAAAAGATGCCTGG + Intergenic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1008820395 6:55625124-55625146 AGTTATCTGCAGAAGACGGCTGG - Intergenic
1009020814 6:57946734-57946756 TGTTACTTTCAAATGATGACAGG + Intergenic
1009214583 6:60905857-60905879 AGTTTCCTGCAACAGAATACAGG + Intergenic
1009308634 6:62122274-62122296 GGTTATCTGCAGAAGATGGCAGG - Intronic
1009390114 6:63135106-63135128 AGTTATCTGCAGAAGATGACAGG + Intergenic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011069098 6:83361637-83361659 ATTTATCTGCAGAAGATGGCAGG - Intronic
1011567755 6:88696467-88696489 TTTTACCTACAAAAGATGAGAGG + Intronic
1011839864 6:91483909-91483931 AATAACCTGCCCAAGATGACAGG - Intergenic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012730458 6:102874291-102874313 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1013406668 6:109849774-109849796 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1013720938 6:113027698-113027720 ATTTACCTGAAAAAGAAGTCAGG - Intergenic
1014329256 6:120039912-120039934 AGTAAGCTGCAAAATAAGACAGG + Intergenic
1014363402 6:120508382-120508404 AGTTATCTGAAAAAGATGGCAGG + Intergenic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1014631638 6:123796773-123796795 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1015095453 6:129409629-129409651 AGTGATCTGCAGAAGATGGCAGG + Intronic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1021318043 7:19175086-19175108 AGTTATCTCCAAAAGGTCACTGG - Intergenic
1021898901 7:25263675-25263697 AGTTTCCAGGAAAACATGACTGG - Intergenic
1022490743 7:30815760-30815782 AGTCAGCTCCAAAAGGTGACTGG - Intronic
1022621741 7:31991505-31991527 AGTTACCTGCAGAAGGGGAATGG + Intronic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1024058916 7:45683832-45683854 AGTTACCTGCAAAAGATGGCAGG + Intronic
1024866099 7:53906315-53906337 AGTTATCTGAAAAAGGTGGCAGG - Intergenic
1026046492 7:66909127-66909149 AGTTATATGCAGAAGATGGCAGG + Intergenic
1027685793 7:81277926-81277948 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1028141732 7:87281955-87281977 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1028935010 7:96455034-96455056 AATTATCTGCAGAAGATGGCAGG - Intergenic
1029312228 7:99678041-99678063 AATTACATGCAATAGATGACTGG - Intronic
1029314383 7:99698130-99698152 AATTACGTGCAATAGATGACTGG - Intronic
1029320021 7:99750626-99750648 AATTACATGCAATAGATGACGGG - Intergenic
1029323080 7:99782383-99782405 AATTAAGTGCAATAGATGACTGG - Intronic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1030298954 7:107956351-107956373 AATCACCTGAAACAGATGACTGG + Intronic
1030368750 7:108673998-108674020 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1030479471 7:110084029-110084051 AGTTTTCTGCAAAGGATGCCAGG - Intergenic
1030931292 7:115525712-115525734 AGTTATCTGCGGAAGATGGCAGG + Intergenic
1031236824 7:119187986-119188008 AGTTATCTGCAGAAGATGACAGG - Intergenic
1031676555 7:124618320-124618342 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1032170168 7:129577969-129577991 AGTTAGCTTCCAAAGAAGACAGG + Intergenic
1033328536 7:140398676-140398698 TGTTAGCTGCAAAAGACGAGAGG + Intronic
1033506649 7:142009390-142009412 AGTAACTTGCACAATATGACAGG - Intronic
1034864492 7:154629371-154629393 AGTTATCTGCATGAGATGTCAGG - Intronic
1037141407 8:15524639-15524661 AGCTACCTGCAAAATATAAAAGG - Intronic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1037917592 8:22781860-22781882 TGTCACCTGCAGAAGATGCCTGG - Intronic
1039077796 8:33708246-33708268 AGTTACCTCCAAAAGGAGATGGG + Intergenic
1040911943 8:52528388-52528410 TGTTATCTGCAGAAGATGGCAGG - Intergenic
1041934551 8:63321300-63321322 AGTTATCTGCAGAAGATGACAGG - Intergenic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1043259973 8:78184223-78184245 AGCTATCTGCAGAAGATGACAGG + Intergenic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1044285975 8:90412476-90412498 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1044436336 8:92168179-92168201 TGTTTCATGCAAAAGATGACAGG - Intergenic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1045341968 8:101263125-101263147 AGTTACCAGAAAAAGATGAATGG + Intergenic
1046063987 8:109175192-109175214 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1046569630 8:115947076-115947098 AGTGACATGCAAAAGAAGAAAGG + Intergenic
1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1046721495 8:117624544-117624566 ATTTTTCTGCAAAAGATTACTGG - Intergenic
1047206696 8:122808052-122808074 AGTGACCTGCCCAAGGTGACGGG - Intronic
1047663296 8:127062079-127062101 AGTTACCAGAAAAAGGTCACTGG + Intergenic
1047782985 8:128124748-128124770 AGTTTCTTGCAAAAAATGACTGG + Intergenic
1048380178 8:133858693-133858715 AGTTGCCTGAGAATGATGACTGG - Intergenic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1050888738 9:10796784-10796806 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1051010105 9:12401716-12401738 AGTCTACTGCAAAAGATGAGAGG + Intergenic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1051966460 9:22834547-22834569 AGTTACCTGCAGAAGATGGCAGG - Intergenic
1052128804 9:24814793-24814815 AGTTACTTGGAAAAGATGATTGG - Intergenic
1052442272 9:28512312-28512334 AGTTATCTGCAGAAGATGACAGG + Intronic
1052797230 9:32934165-32934187 AGTTACATGAAAAAGATAATTGG - Intergenic
1053695960 9:40639533-40639555 AGTTAACTGGAGAAGATGACCGG + Intergenic
1054307207 9:63438751-63438773 AGTTAACTGGAGAAGATGACCGG + Intergenic
1054405940 9:64762743-64762765 AGTTAACTGGAGAAGATGACCGG + Intergenic
1054439566 9:65248230-65248252 AGTTAACTGGAGAAGATGACCGG + Intergenic
1054490841 9:65773709-65773731 AGTTAACTGGAGAAGATGACCGG - Intergenic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056156662 9:83845179-83845201 AGTTAGCTGCAGAAGATGGCGGG - Intronic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1059196508 9:112375898-112375920 AGTTATCTGCAGAAGAAGGCAGG + Intergenic
1059909689 9:119028612-119028634 AATTTCCTGCAAAAGTTGATTGG + Intergenic
1060196752 9:121628973-121628995 ACCGACCTGCAAAAGGTGACAGG + Intronic
1061200611 9:129136454-129136476 AGGTACCTGCACAGGAGGACAGG - Exonic
1061849986 9:133408908-133408930 TGTTACTTGCAAAAGGTGGCGGG - Intronic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1062362721 9:136195298-136195320 AGTTCCCCCCAAAAGATGGCTGG + Intergenic
1202778407 9_KI270717v1_random:13146-13168 AGTTAACTGGAGAAGATGACCGG + Intergenic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1186469770 X:9812139-9812161 AGTTGTCTGCAGAAGATGGCAGG + Intronic
1186825521 X:13336134-13336156 TTTTACCTGCAAAAAAGGACGGG - Intergenic
1187490913 X:19750489-19750511 AGTTACTTCCAAAAGACCACAGG + Intronic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1188773637 X:34186287-34186309 AGTGTCCCGCAATAGATGACTGG - Intergenic
1189154887 X:38746752-38746774 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1190337761 X:49272698-49272720 TGGTAACTGCAAAAGATAACTGG + Intronic
1190996751 X:55617499-55617521 AGTTATCTACAGAAGATGGCAGG + Intergenic
1191630040 X:63312619-63312641 AGTTATCTGAAGAAGTTGACAGG + Intergenic
1191658808 X:63629837-63629859 AGTTATCTGCTGAAGATGGCAGG + Intergenic
1191694391 X:63974833-63974855 AGTGTCCATCAAAAGATGACTGG + Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1191779768 X:64853289-64853311 AGTTACCTGAAAAAGAATTCAGG - Intergenic
1191941263 X:66483896-66483918 AGTTATCTGCAGAAGATGACAGG + Intergenic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192673256 X:73168448-73168470 GGTTACCTGCAGAAGATGGCAGG + Intergenic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193053487 X:77125736-77125758 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1193447152 X:81618739-81618761 AGTTATCTGCAGGAGATGGCAGG - Intergenic
1193832946 X:86310065-86310087 AGTTATCTGCAGAAGATGACAGG - Intronic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193957280 X:87878178-87878200 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
1194179594 X:90695967-90695989 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194443546 X:93961071-93961093 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1194513420 X:94822284-94822306 AGTTATCTGCAGAAGATGACAGG + Intergenic
1194521079 X:94919407-94919429 AGTTATCTGCAAAAGATGACAGG - Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1197002284 X:121452889-121452911 AGTTATCTGCAGAAGATGACAGG - Intergenic
1197044411 X:121978294-121978316 AGTTACCTGCAGAATATGGCAGG - Intergenic
1197097464 X:122612806-122612828 AGTTATCTGCAGAAGATGGTAGG - Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1197372060 X:125637898-125637920 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1197380003 X:125727937-125727959 AGTTTTCTGCAGAAGATGGCAGG + Intergenic
1197409326 X:126096447-126096469 AGTTATATGCAGAAGATGGCAGG + Intergenic
1197477361 X:126941361-126941383 AGTTATCTGCATAAGATGACAGG + Intergenic
1197591864 X:128419355-128419377 AGTTATCTGCAGAAGATGACTGG - Intergenic
1197597507 X:128483732-128483754 AGTGACCATCAACAGATGACTGG - Intergenic
1198840234 X:140848651-140848673 AGTTACCTACACCAGATGGCTGG - Intergenic
1199024376 X:142919687-142919709 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1199580347 X:149354143-149354165 AGTTACCTGTGAATGATGGCAGG - Intergenic
1200340497 X:155390672-155390694 AGTTATCTGCAGAAGATGACAGG + Intergenic
1200521268 Y:4211998-4212020 AGTTATCTGCAGAAGATTTCAGG - Intergenic
1200526256 Y:4278136-4278158 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1200709922 Y:6474113-6474135 AGGTGTCTGCAAAAGATGGCTGG + Intergenic
1200746061 Y:6904904-6904926 AGTTACCCACAGAAGATGGCAGG + Intergenic
1201024193 Y:9690595-9690617 AGGTGTCTGCAAAAGATGGCTGG - Intergenic
1201193721 Y:11471449-11471471 AGTTAACTGGAGAAGATGACAGG + Intergenic
1201796633 Y:17903443-17903465 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1201798423 Y:17926667-17926689 GGTTATCTGCAGAAGATGGCAGG - Intergenic
1201803130 Y:17979290-17979312 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1201804922 Y:18002542-18002564 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1201898792 Y:19024595-19024617 AGGTACCTGCAAAAGAGGTTAGG + Intergenic
1202177213 Y:22108819-22108841 AGTTGTCAGCAAAAGATGGCCGG + Intergenic
1202214148 Y:22477565-22477587 AGTTGTCAGCAAAAGATGGCCGG - Intergenic
1202358017 Y:24072505-24072527 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1202359743 Y:24095357-24095379 GGTTATCTGCAGAAGATGGCAGG - Intergenic
1202511035 Y:25574757-25574779 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1202512761 Y:25597608-25597630 AGTTATCTGCAGAAAATGGCAGG - Intergenic