ID: 1093053630

View in Genome Browser
Species Human (GRCh38)
Location 12:14532856-14532878
Sequence CAGTCTCAGGATGCTGGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 1, 2: 1, 3: 40, 4: 359}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093053630 Original CRISPR CAGTCTCAGGATGCTGGAGG GGG Intronic
900207403 1:1437477-1437499 CATTCTCGGTATGCGGGAGGAGG + Exonic
900598192 1:3491869-3491891 CAGCCTCAGGGTCCTGAAGGTGG + Intronic
900720414 1:4172296-4172318 CAGTCGCATGAGGGTGGAGGAGG - Intergenic
900751091 1:4398136-4398158 CGGAGTGAGGATGCTGGAGGAGG + Intergenic
900885679 1:5413782-5413804 AATGTTCAGGATGCTGGAGGGGG - Intergenic
900885707 1:5413943-5413965 AATGTTCAGGATGCTGGAGGGGG - Intergenic
900885726 1:5414060-5414082 GATGCCCAGGATGCTGGAGGGGG - Intergenic
900940134 1:5793286-5793308 CAGCCTCAGGCTGTTGGAGATGG - Intergenic
901230552 1:7639657-7639679 CAGCCTCAGGAGGCTGAAGTGGG + Intronic
902129125 1:14243371-14243393 CAGTCTCTGGGAGGTGGAGGAGG + Intergenic
902558935 1:17264895-17264917 CAGCCTCAGGAGGCTGAAGTGGG + Intronic
902629399 1:17695785-17695807 CATTCTCAGGGTGGTGGAGGGGG - Intronic
904618787 1:31763580-31763602 CTGTGTCAGAATTCTGGAGGGGG + Intronic
904954070 1:34268400-34268422 GAGTCAGAGGATGCTGGAGCTGG - Intergenic
905441157 1:37997251-37997273 CAGTTTGGGGATGCTGGAGTGGG + Exonic
906669366 1:47643481-47643503 CCACCTCAGGATGCTGGTGGTGG + Intergenic
907177491 1:52538533-52538555 CAGTCTCAGGAGGCTGAAGTGGG + Intronic
907299540 1:53477912-53477934 CTGGCTCAGGCAGCTGGAGGTGG - Intergenic
907626874 1:56039134-56039156 CATTCTGTGAATGCTGGAGGGGG - Intergenic
908419269 1:63943610-63943632 CTGTCTCTGCAGGCTGGAGGTGG + Intronic
909326561 1:74358291-74358313 CAGTGACAGGAAGCTGGAGGTGG + Intronic
909854097 1:80506460-80506482 CAGTCTCAGCATGCAGGCTGTGG + Intergenic
912519536 1:110235590-110235612 CCGTTTCAGGCTGCTGGAAGAGG + Intronic
912560851 1:110550550-110550572 CAGCCTCTGGAGGCTGGAAGAGG - Intergenic
914437417 1:147671987-147672009 CAGTCACAGGATGAGGGGGGAGG + Intergenic
914921441 1:151850244-151850266 CAGTCACTGAAGGCTGGAGGTGG - Intronic
917437299 1:175034238-175034260 CAGTCACCAGAGGCTGGAGGAGG - Intergenic
917593547 1:176503148-176503170 CAGTGTCTGGATGGTGGAGTAGG - Intronic
917740958 1:177961689-177961711 CAGACTCACGCTGCTGGAGAAGG + Exonic
918507632 1:185273890-185273912 GTGACTCAGGAGGCTGGAGGTGG + Intronic
920345922 1:205305590-205305612 CACTCTCAGGAGGCTGGACTGGG + Intronic
920834270 1:209494019-209494041 CTGTGTCAGGATGGTGAAGGAGG + Intergenic
921498024 1:215864676-215864698 CAGTGTATGGAAGCTGGAGGAGG + Intronic
922572912 1:226644351-226644373 CACTCACAGGACGCTGGGGGAGG + Intronic
923085004 1:230696551-230696573 CAGCCACAGGACGCTGGAGGAGG - Intergenic
923966552 1:239147151-239147173 CAGTCTCAGGTTGGTGGGAGGGG + Intergenic
1062824572 10:558302-558324 CAGGGTCAGGAAGCGGGAGGTGG - Intronic
1064550074 10:16491733-16491755 GAGTCCCAGCATTCTGGAGGGGG - Intronic
1064909034 10:20379881-20379903 CAGACTGAGGATGTTGGTGGTGG - Intergenic
1065865838 10:29914601-29914623 CGTGCTCAGGATGGTGGAGGAGG - Intergenic
1066374575 10:34846085-34846107 TAGTCTCAGGATGGGGGTGGGGG - Intergenic
1068577409 10:58699804-58699826 CCATCTCAGGAGGCTGGAGCAGG - Intronic
1069425485 10:68285145-68285167 CAGTCTCTGTATGTTGGGGGAGG + Intronic
1069444879 10:68463836-68463858 CAGTCTTGGTAAGCTGGAGGTGG - Intronic
1069510117 10:69035937-69035959 CAGCCTCTGGAGGCTGGAGAAGG - Intergenic
1069846006 10:71372083-71372105 CGGTCACAGGATGCAAGAGGTGG + Intergenic
1070494073 10:77005401-77005423 CAGTCTCAGGAAGCTGCAGCAGG - Intronic
1070754940 10:78986082-78986104 CAGCCTCAGAATGGTGAAGGTGG + Intergenic
1070933250 10:80275236-80275258 CAGCCCCTAGATGCTGGAGGGGG + Intronic
1071526030 10:86358974-86358996 CAGTCTTTGGAAGCTGGAGAAGG + Intronic
1073552366 10:104415234-104415256 CAGTTGCAGGAAGCTGGAGTCGG + Intronic
1074133200 10:110602564-110602586 CAGTCTCAAGATGAAGGAGAAGG + Exonic
1074832526 10:117259511-117259533 CACTCTCAGGAAGCTGTGGGAGG - Intronic
1075262516 10:120975556-120975578 ATTTCTCAGTATGCTGGAGGGGG + Intergenic
1076003523 10:126930593-126930615 CAGTCTCACAAGGCTGGAGAGGG - Intronic
1076311665 10:129512078-129512100 CAGATGCAGGATGCTGGAGATGG + Intronic
1076562869 10:131378317-131378339 CAGGCTCAGTAGGCTGGAGAGGG - Intergenic
1077026451 11:442032-442054 CAGCTGCAGGACGCTGGAGGAGG - Intergenic
1077404226 11:2375717-2375739 CACTCTCAGGAAGTGGGAGGAGG - Intergenic
1077551410 11:3202112-3202134 CATGCTCAGGGTGCTGGAAGAGG - Intergenic
1078849270 11:15149290-15149312 CAGCCTCAGGATGCTGGAACTGG - Intronic
1079668929 11:23141890-23141912 CAGGCTCAGGGTGGTGGTGGGGG - Intergenic
1080575126 11:33591883-33591905 GAGTCTCATGATGGAGGAGGCGG + Intronic
1081747907 11:45485904-45485926 CAGGCCCAGGCTGCTGGAGGTGG - Intergenic
1081893043 11:46560937-46560959 CAATATCAGGAGGCTGGAGTAGG + Intronic
1082874002 11:57969866-57969888 CAGTCACAGGAAGGTGGTGGGGG + Intergenic
1083561918 11:63679880-63679902 CAGCCTCATGAAGCGGGAGGTGG - Intergenic
1083631362 11:64097163-64097185 CAGGCTCAGGATGCTGCAGAGGG - Intronic
1083902501 11:65650446-65650468 CATGCTCAGGAAGCTGCAGGAGG + Exonic
1084635783 11:70391608-70391630 AAGTCACAGGATGATGTAGGCGG - Intergenic
1084765868 11:71308018-71308040 CTCACTCAGGAGGCTGGAGGTGG + Intergenic
1085558033 11:77443201-77443223 TAGTCTCAGGATGCTGAGGCAGG + Intronic
1085772673 11:79339107-79339129 CACTCTCCTGATGCTGGAGTTGG - Intronic
1085781070 11:79409681-79409703 CAGTCTATGGAGGCTGCAGGTGG - Intronic
1088037389 11:105334191-105334213 CAGTGGCAGCACGCTGGAGGTGG + Intergenic
1088220408 11:107564941-107564963 CAAACTCAGAATTCTGGAGGAGG - Intronic
1088927160 11:114314027-114314049 CAGCCTGAGGATGCTGGAAAGGG + Intergenic
1089398673 11:118152283-118152305 GAGGTTCAGGATGCTGGAGGAGG - Intronic
1090468651 11:126958448-126958470 CAGTCTCAGGATCTTGAATGTGG - Intronic
1091479370 12:810880-810902 CAGTTCCAGGCTGCTGGGGGTGG - Intronic
1093053630 12:14532856-14532878 CAGTCTCAGGATGCTGGAGGGGG + Intronic
1093378584 12:18461889-18461911 CAGTCTCTTGAAGCTGGAAGAGG - Intronic
1095947481 12:47761698-47761720 CAGTCAGAGGAGGGTGGAGGCGG - Intronic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1096896130 12:54821937-54821959 CAGCCTAAGGATCCTGGAGGTGG - Intergenic
1098797210 12:74905011-74905033 ATGTCTGAGGATGCTGGAGGAGG - Intergenic
1100142229 12:91633231-91633253 CAGACTCAGGAAGCCTGAGGAGG + Intergenic
1101016678 12:100508233-100508255 CAGGCTCAGGAAGCAGCAGGTGG + Intronic
1102010521 12:109615774-109615796 CTGGCTGAGGATTCTGGAGGGGG + Intergenic
1102665159 12:114565574-114565596 CAGTACCAAGGTGCTGGAGGTGG - Intergenic
1102965157 12:117120032-117120054 AGGTCTCAAGATGTTGGAGGAGG - Intergenic
1103512233 12:121483310-121483332 CAGTCTCAAGATGCTAGTGGAGG + Intronic
1103566829 12:121820282-121820304 CAGCATCACGATGCCGGAGGGGG - Intronic
1105014433 12:132777494-132777516 GAGGCTCAGGATTCTGGAGACGG + Intronic
1106340850 13:28825102-28825124 CAGCCTCAGGTGGCTGGAGTGGG - Intronic
1106421691 13:29590689-29590711 TAGTCCCAGGGTGCTGGAGGAGG - Intronic
1109145214 13:58771748-58771770 AAGGCTCAGGAGGCTGCAGGTGG - Intergenic
1110239791 13:73254378-73254400 CAGTCCCAGAAGGCTGGAGCTGG + Intergenic
1113248919 13:108429423-108429445 GAGTTTCATGAGGCTGGAGGTGG - Intergenic
1113542477 13:111119767-111119789 CAGTGTCAGGATTCTGGGGTTGG + Intronic
1114500581 14:23165424-23165446 CAGCCTCAGGAACCTGAAGGAGG + Exonic
1114629071 14:24147689-24147711 CTGCCTCAGGATGCCGGGGGAGG + Exonic
1114721745 14:24889955-24889977 CAGTCTCTGGATGTTAGAAGAGG - Intronic
1114866800 14:26605521-26605543 CAGTGTCAGGAAGATAGAGGGGG + Intergenic
1115325260 14:32130650-32130672 TAGTCTCAGGAGGCTGAAGCAGG - Intronic
1119601331 14:75979157-75979179 CAGCCACAGGAAGCTGGAGCGGG + Intronic
1120117584 14:80637902-80637924 CAGTCACCAGATGCTGGAAGAGG + Intronic
1120738293 14:88079480-88079502 CAGTGTCAGGAAGCTGGCAGAGG - Intergenic
1121312667 14:92943609-92943631 TTGTCTGGGGATGCTGGAGGAGG - Intronic
1121708221 14:96017174-96017196 CAAGGTGAGGATGCTGGAGGAGG - Intergenic
1121830856 14:97050877-97050899 GAGTCTCAGGATACTGGGGAGGG + Intergenic
1122409018 14:101516763-101516785 CAGCATGGGGATGCTGGAGGAGG - Intergenic
1124409776 15:29427533-29427555 CAGTCTCTGGAAGCTGGAGAAGG - Intronic
1124500134 15:30221064-30221086 CAGTCTCGGGATGCTCTGGGAGG + Intergenic
1124743441 15:32317602-32317624 CAGTCTCGGGATGCTCTGGGAGG - Intergenic
1126807184 15:52362765-52362787 CCGTGTCAAGCTGCTGGAGGAGG + Intronic
1127200681 15:56646316-56646338 CAGTCTCAGGAGGCTGAGGCAGG + Intronic
1128468307 15:67930919-67930941 CAGACTAAGGAAGCTGGAGGGGG + Intergenic
1128470336 15:67946339-67946361 CAGTCTCAGAATCCTGGAGCAGG + Intergenic
1128553075 15:68610568-68610590 AACGCGCAGGATGCTGGAGGAGG - Intronic
1128576864 15:68782207-68782229 CAGTGCCAGGAACCTGGAGGAGG + Intronic
1128658381 15:69479232-69479254 CACTCGCAGGATGCTGAAGCTGG - Intergenic
1128694846 15:69753748-69753770 TTGTCTCAGGATGCTGCTGGAGG + Intergenic
1131410746 15:92205698-92205720 ATGTCTCTGGGTGCTGGAGGAGG - Intergenic
1132397154 15:101482372-101482394 CAGTCCCAGGAGCCAGGAGGAGG + Intronic
1132605146 16:790522-790544 CAGTCTCAGGTCGGGGGAGGAGG + Exonic
1132709168 16:1258868-1258890 GAGGCTCAGGATGGAGGAGGGGG - Exonic
1132743669 16:1428073-1428095 GAGCCTCTGGATGCTGGAGGGGG - Intergenic
1132871444 16:2117392-2117414 GAGTCTCAGGAGGAAGGAGGTGG - Intronic
1132910442 16:2307926-2307948 ATGTCTCAGGAAGCTGGAAGAGG + Intronic
1133113904 16:3565099-3565121 CTGTCCCAGGCTGCTGGATGGGG - Exonic
1133416891 16:5613819-5613841 CAGTCTTCGGATGCTGGCTGGGG - Intergenic
1133460154 16:5980424-5980446 GTGTCTCAGGATCCTGCAGGAGG + Intergenic
1133982636 16:10644881-10644903 CTGTCCCAGTGTGCTGGAGGTGG + Intronic
1134507899 16:14823018-14823040 CAGGCTCAGCAGGCTGGTGGCGG + Intronic
1134521084 16:14919502-14919524 GAGTCTCAGGAGGAGGGAGGTGG + Intronic
1134550487 16:15136470-15136492 GAGTCTCAGGAGGAGGGAGGTGG - Intronic
1134695600 16:16221781-16221803 CAGGCTCAGCAGGCTGGTGGCGG + Exonic
1134708760 16:16318153-16318175 GAGTCTCAGGAGGAGGGAGGTGG + Intergenic
1134715974 16:16358187-16358209 GAGTCTCAGGAGGAGGGAGGTGG + Intergenic
1134950845 16:18350492-18350514 GAGTCTCAGGAGGAGGGAGGTGG - Intergenic
1134958782 16:18393972-18393994 GAGTCTCAGGAGGAGGGAGGTGG - Intergenic
1134976229 16:18572905-18572927 CAGGCTCAGCAGGCTGGTGGCGG - Intergenic
1135265518 16:21022266-21022288 CAGTCTTAGGACCCTGAAGGAGG - Intronic
1136451919 16:30358385-30358407 GAGGCTGAGGAGGCTGGAGGAGG + Exonic
1138877002 16:60964379-60964401 CTGTATCATGATGCTGAAGGAGG + Intergenic
1140384219 16:74520213-74520235 AATTCTGAGGATGCTGGAGAAGG - Intronic
1140568039 16:76066984-76067006 CAGTCTCAAGGTGCAGGAGTTGG + Intergenic
1140873658 16:79130150-79130172 CAGTCACAGGCTGGTGGAGTTGG + Intronic
1141910432 16:87054880-87054902 CAGCCTCTGGAAGCTGGAGAAGG + Intergenic
1141915605 16:87094379-87094401 CTGTCTAAGGTTGCTGGTGGTGG + Intronic
1142256983 16:89018774-89018796 CAGCCTCCGGAAGCAGGAGGTGG + Intergenic
1142470708 17:161828-161850 GCCTCTCAGGGTGCTGGAGGTGG - Intronic
1143028659 17:3955201-3955223 CAGTGTCAGGAAGAAGGAGGTGG - Intronic
1143783965 17:9243334-9243356 CAGTCGCGGCATGCTGGAGAGGG + Exonic
1144671651 17:17136209-17136231 CAGGCCCAGGCTCCTGGAGGAGG - Exonic
1144707807 17:17380941-17380963 CAGCCTCAGGAGGCCGGTGGAGG - Intergenic
1145278790 17:21453738-21453760 CACTGTCAGGAAGCAGGAGGAGG - Intergenic
1146439427 17:32880913-32880935 CACTTCCAGGATGCTGCAGGAGG - Intergenic
1146659955 17:34659057-34659079 CAGGCCCAGGATGCTGGACCGGG + Intergenic
1147371438 17:39995575-39995597 CAATCTCAGGAGGCAGGAGTGGG + Intronic
1147712406 17:42478568-42478590 CAGTCACAGGATCCTCCAGGGGG - Exonic
1149048159 17:52271567-52271589 CGGTCTCAGGATGCCAGAGGAGG - Intergenic
1149549637 17:57530883-57530905 CATTCTGAGGATGCTGTAGAGGG - Intronic
1149809658 17:59655904-59655926 CAGTCTCAAGATCATAGAGGTGG - Exonic
1152042738 17:77915047-77915069 CAGTCTTAGGATGGTGGGGCGGG - Intergenic
1152163196 17:78682553-78682575 CTTTCTCAGGATGCTGGTGGAGG - Intronic
1152210095 17:78998561-78998583 CAGGGTCAGGGTGCTGGTGGCGG + Intronic
1152277798 17:79368305-79368327 CAGCCCCAGGCTGGTGGAGGGGG - Intronic
1152724845 17:81940102-81940124 GAGTCTCCGCAGGCTGGAGGTGG - Exonic
1152755156 17:82084140-82084162 CATCCCCAGGACGCTGGAGGAGG - Exonic
1155636614 18:27963485-27963507 CAGTGTCAGGCTGCTGCAGCTGG + Exonic
1156152080 18:34254352-34254374 CATTTTCAGGGGGCTGGAGGTGG + Intergenic
1157717059 18:49895033-49895055 CAGCCTCAGGCTGCAGGAGGAGG - Exonic
1157745744 18:50133763-50133785 GAGTCCCAGGCTCCTGGAGGTGG - Intronic
1158554814 18:58466439-58466461 CAGGCTCAGCATGGTGGTGGGGG - Intergenic
1159505355 18:69328443-69328465 CAGGGGCAGGGTGCTGGAGGAGG - Intergenic
1160049812 18:75422169-75422191 CATTCACAGGATGCTGTGGGAGG + Intronic
1160282031 18:77499658-77499680 CAATTTCAAGATGCTGGTGGGGG + Intergenic
1162433739 19:10644399-10644421 CTGTCCCAGGATCCTGGAGAGGG + Exonic
1162722333 19:12669921-12669943 CGATCTCAGGAGGCGGGAGGAGG - Exonic
1163536173 19:17877909-17877931 TAGCCTCAGGCTGGTGGAGGGGG - Intronic
1164904143 19:31953321-31953343 CAGTCTGAGAAAGCTGCAGGAGG - Intergenic
1165461221 19:35945297-35945319 CAGTCTGAGGACCCCGGAGGAGG + Exonic
1166747327 19:45147536-45147558 GGGTCTCAGGATGCTGGATATGG + Intronic
1166864029 19:45825499-45825521 CAGTCACGGGAGGCTGGAGGTGG - Intronic
1167488291 19:49776203-49776225 GAGTCTGAGGATGCGGGCGGCGG - Intronic
1168111939 19:54197552-54197574 CTGTCTCAGGGTGCCAGAGGTGG - Intergenic
924965430 2:72374-72396 CAGTCTCTAGAAGCTGGAAGAGG + Intergenic
925772333 2:7295185-7295207 CAGTCTCAGGAGTCTGAAAGGGG + Intergenic
926195586 2:10761847-10761869 CAGACTTAGGATGCTGGTGTTGG - Intronic
928174870 2:29026804-29026826 CAGTCTCAGGATAGTGGTGTGGG - Intronic
928370330 2:30735893-30735915 CAGTCTCAGGGTGCAGGGAGGGG + Intronic
929055069 2:37869565-37869587 CAGGCTCATGATGCCGGGGGAGG + Intergenic
929188165 2:39116737-39116759 CAGTCTCAGGAGGCTGAGGTGGG + Intronic
929316466 2:40484865-40484887 CAGCAGAAGGATGCTGGAGGTGG + Intronic
929559953 2:42950160-42950182 TTGTCTGTGGATGCTGGAGGGGG - Intergenic
930561015 2:52959908-52959930 CAGGCTCAGGATGCGGTGGGTGG + Intergenic
931827839 2:66019832-66019854 CAGCCACAGGAAGCTGGAGGAGG - Intergenic
932336228 2:70932864-70932886 CAGCCGCAGAATGTTGGAGGTGG - Exonic
932376740 2:71242521-71242543 CAATCTCAAGATGCTTGAGTAGG + Intergenic
934810051 2:97270014-97270036 CAGCCTGAGGACACTGGAGGAGG - Intergenic
934827641 2:97437925-97437947 CAGCCTGAGGACACTGGAGGAGG + Intergenic
935008162 2:99102294-99102316 CAGTCTCAAGATGAAGGAGAAGG + Intronic
935270400 2:101429615-101429637 CATTCTCAAGATGCCAGAGGTGG + Intronic
936450026 2:112626943-112626965 TAGTCTCAGGATGCTACAGAGGG - Intergenic
937883876 2:126887089-126887111 CGGTCTCAGGAGGCAGGAGCCGG - Intergenic
938056621 2:128220283-128220305 GGGGCGCAGGATGCTGGAGGTGG + Intergenic
938178958 2:129162635-129162657 CAGCCCCAGGATGCAGGAGGAGG + Intergenic
938259420 2:129884480-129884502 CAGTCTCAGGATGGTGGATGGGG + Intergenic
940018958 2:149136402-149136424 GAGTCTCTGGATGCTGGAGTTGG - Intronic
940867186 2:158829140-158829162 CAGGCACAGGCTGCTAGAGGAGG + Intronic
941102354 2:161310048-161310070 CTACCTCAGGAGGCTGGAGGTGG + Intronic
941663308 2:168217354-168217376 CAGTATCCGGATGCAGGACGGGG + Intronic
942227801 2:173832073-173832095 TAGGCTCTGGGTGCTGGAGGGGG - Intergenic
944395725 2:199263801-199263823 TAGTGTCATGATGCTGGATGAGG + Intergenic
944546092 2:200800159-200800181 CAGTCTCTGGAAGCTGGCGAAGG + Intergenic
944907307 2:204275395-204275417 AAGACTCAGGATGCAAGAGGAGG - Intergenic
946339667 2:219059371-219059393 TAGTCTCTGCATGCTGGAGTAGG - Intronic
946345817 2:219109613-219109635 CAGACTCTGCGTGCTGGAGGCGG + Intronic
946606446 2:221410598-221410620 CTGACTCAGGATCCTGAAGGAGG + Intergenic
947904400 2:233749890-233749912 CAGTTCCAGGTGGCTGGAGGGGG - Intronic
947948124 2:234124146-234124168 CATTCTCAGAAGGCAGGAGGAGG + Intergenic
948244125 2:236463944-236463966 AGTTCTCAGGCTGCTGGAGGGGG + Intronic
948300050 2:236898909-236898931 CAGTCTCCGCAAGCTGGATGGGG - Intergenic
948470167 2:238172450-238172472 GAGTCTCAGGACACTGGAAGGGG - Intronic
948735170 2:239998980-239999002 CAGGCTCAGGATGCTGCACCAGG + Intronic
1168742184 20:201209-201231 TAATCTCTGGGTGCTGGAGGAGG - Intergenic
1169809605 20:9596211-9596233 CTGACCCAGGATGCTGGAGCAGG + Intronic
1170092019 20:12599742-12599764 GAGACTCAGAAAGCTGGAGGTGG + Intergenic
1170891582 20:20380711-20380733 CAGCCCCAGCATGCTGGAGAAGG - Intergenic
1171185575 20:23121875-23121897 CAGGCACAGGATGGTGGGGGTGG + Intergenic
1171464266 20:25316813-25316835 CAGTCTCAGGAGGCTGAAGCAGG + Intronic
1172685213 20:36748667-36748689 CGGTATCAGTATGCTGCAGGAGG - Intergenic
1173494419 20:43508317-43508339 CAGTCCCGGGAGGCTGGTGGCGG + Intronic
1173866782 20:46317571-46317593 GAGTTCCAGGAGGCTGGAGGAGG - Intergenic
1175831514 20:61967460-61967482 CTGTCTGCTGATGCTGGAGGTGG - Intronic
1176221799 20:63972877-63972899 CAGTGTCAGGGTGCTGGTGAGGG + Intronic
1177821292 21:26033521-26033543 AATTCTCAGTATGGTGGAGGAGG + Intronic
1178436066 21:32559356-32559378 CAGTCACAGGATGAAAGAGGAGG - Intergenic
1178632426 21:34274039-34274061 ATGTTTCAGGAAGCTGGAGGGGG - Intergenic
1181388451 22:22561007-22561029 CTGTCTCAGGAAGCTGGGTGTGG + Intronic
1182476321 22:30578584-30578606 CAGACTCAGGAAGCCGGATGCGG + Intronic
1183720062 22:39557481-39557503 CAGGCGCGGGACGCTGGAGGGGG - Intergenic
1184158200 22:42682748-42682770 CAGCCTCAGGATCTTGGAGAAGG - Intergenic
1184408898 22:44315422-44315444 CAGTCCCAGGCTGCTGGGTGTGG + Intergenic
1185001210 22:48247272-48247294 CAATCTCAGGAGGCTGAAGCAGG + Intergenic
949358232 3:3204073-3204095 CAGCCTCAAGAAGCTGGAAGAGG + Intergenic
950498571 3:13349346-13349368 CAGTCTCAGCAAGCTGTAGCTGG - Intronic
951774249 3:26291218-26291240 GAGTCTCAGGATGATCCAGGTGG - Intergenic
952723370 3:36556531-36556553 TAGTCTCTGGATGGTGGTGGAGG - Intergenic
953702745 3:45209499-45209521 CAGTCTTGGGCTGCTGGAGGGGG + Intergenic
953784248 3:45898531-45898553 CAGGAGCAGGATCCTGGAGGCGG - Intronic
954085386 3:48240164-48240186 TTATCTGAGGATGCTGGAGGAGG + Intergenic
955896568 3:63706868-63706890 CAGTCTCCAGATGCTGGAATAGG - Intergenic
956163920 3:66382209-66382231 GTGTCTCTGGGTGCTGGAGGTGG - Intronic
959498148 3:107074838-107074860 CAGACACAGGATATTGGAGGTGG - Intergenic
961105473 3:124237290-124237312 CAGGCTCTGGTTGTTGGAGGTGG + Intronic
961507545 3:127380451-127380473 CACTCTTAGGCTGCTGGTGGGGG + Intergenic
964798873 3:160531128-160531150 AAAAATCAGGATGCTGGAGGAGG - Intronic
965165255 3:165188687-165188709 CTGTTTGAGGATGGTGGAGGTGG - Exonic
966313146 3:178616490-178616512 GTGTCTCTGGATGCTGGGGGAGG - Intronic
968964043 4:3760506-3760528 CAGGCCCAGGATGGTGGAGCAGG + Intergenic
969340145 4:6535307-6535329 CTCTCTCAGGATGCGTGAGGCGG - Intronic
969489035 4:7488392-7488414 CAGTCTCAGGCTGAGGGATGAGG + Intronic
971975770 4:33684420-33684442 CAGTCTCCAGATGCTGAGGGTGG - Intergenic
972270080 4:37502502-37502524 CAGGCACAGGGTGCTGGTGGGGG + Intronic
972454258 4:39237775-39237797 CATCCTCAGGATGCAGGTGGAGG - Intronic
972885244 4:43477131-43477153 TAGTCTCTGCATGCTGCAGGAGG - Intergenic
972958562 4:44422876-44422898 CAGCCTCAGGATGGTAGAGGTGG + Intronic
972992670 4:44841080-44841102 CAGTCTCAGGACAGTGTAGGGGG + Intergenic
978352419 4:107833939-107833961 CAGTCTCCAGAATCTGGAGGAGG + Intronic
979274253 4:118797106-118797128 CAGTGTCAGGATGCTGCCAGTGG - Intronic
980765635 4:137300411-137300433 CAGCCTCAGGCTGTTGCAGGTGG - Intergenic
982456337 4:155613402-155613424 CAGTCTGGAGATGCTGGAGAAGG - Intergenic
986310005 5:6544683-6544705 CAGTCACATGAAGATGGAGGTGG + Intergenic
986328912 5:6703116-6703138 CAGGCTCAGGAGGCTGCAGTGGG - Intergenic
986748854 5:10767091-10767113 GTGTCTCAGGATCCTGTAGGGGG - Intergenic
986796410 5:11216916-11216938 CATTCTTTGGCTGCTGGAGGAGG + Intronic
986835422 5:11631741-11631763 TAGTCTCAGCATGCTGCAGCAGG - Intronic
988539638 5:32097416-32097438 CATTCTGAGGCTGCTTGAGGGGG - Intronic
991006357 5:61832122-61832144 CACTCACAGGATGCAGAAGGAGG - Intergenic
991058728 5:62348126-62348148 TTGGCTGAGGATGCTGGAGGTGG - Exonic
992593998 5:78327145-78327167 CACTCTCAGGAGGATGGAGAAGG - Intergenic
993430642 5:87828653-87828675 AAGTTTCAGGATGGTGGAAGTGG - Intergenic
994917118 5:105994735-105994757 CTGTTTCAGGATGCTGGGGAAGG - Intergenic
995054749 5:107746524-107746546 CAGTCTCAGAAGCCTGGAGTTGG + Intergenic
995271122 5:110220472-110220494 CAGTCTGAGAATGCTGGTTGGGG + Intergenic
996425384 5:123308022-123308044 CAGCCTCCAGATGCTGGAAGAGG - Intergenic
999094914 5:148969176-148969198 CAGTCTAATGAACCTGGAGGGGG - Intronic
999193999 5:149769767-149769789 CAGTCTCTGGAAGCTGGAAAAGG - Intronic
1000393385 5:160748229-160748251 CAGTTTCAAGATGCTGGGGAGGG - Intronic
1001444540 5:171773236-171773258 CAGTCTCAGGGAGGTGGTGGGGG + Intergenic
1001559947 5:172662544-172662566 CTGTCTCAGGCTGCTGGCAGGGG - Intronic
1002402284 5:178997380-178997402 CTGTATCAGGATGCTGTAAGAGG - Intergenic
1002925333 6:1602419-1602441 CAGCCAGAGGAGGCTGGAGGAGG - Intergenic
1005496449 6:26392278-26392300 AAGTCTCAGAAAGCTGAAGGGGG - Intronic
1005661953 6:28007397-28007419 CAGTCTCAGGAGGCTGAGGCAGG - Intergenic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1007178911 6:39914595-39914617 CAGGCTGGGGGTGCTGGAGGGGG - Intronic
1007306747 6:40912701-40912723 CAGTCTCAGCACGCTAGAGAGGG + Intergenic
1007418979 6:41707943-41707965 CAGCCTCAGGATGCTAGAGTTGG + Intronic
1008104695 6:47428928-47428950 CAGTGTCATGAGGCTGCAGGGGG + Intergenic
1008457371 6:51726565-51726587 CTGGCCCAGGAAGCTGGAGGGGG - Intronic
1008577986 6:52879646-52879668 CATTCTCAGGGTGCTGGGGATGG + Intronic
1009306182 6:62092161-62092183 GAGTCTCAGGTTGCTGGAAATGG - Intronic
1010073271 6:71769601-71769623 AAGTCTCTGGATGCTGGTGCAGG - Intergenic
1010865216 6:80967939-80967961 CAGGCTCATGATGCTGGTGATGG - Intergenic
1011464510 6:87641496-87641518 TAGTGTCAGGATGGGGGAGGAGG - Intronic
1012864240 6:104598280-104598302 CAATTTCAGGATGCTGATGGTGG - Intergenic
1013296767 6:108764631-108764653 CAGTCATAGGATTCTGGAGGAGG + Intergenic
1017159163 6:151349324-151349346 CAGTTTCAGGAAGCCGAAGGAGG + Exonic
1017348840 6:153415864-153415886 CAGTCACAGGATGAAAGAGGAGG - Intergenic
1017568079 6:155709965-155709987 CACTTTCAGAATGCTGGAGTAGG + Intergenic
1017953790 6:159161121-159161143 CAGTGTTAGGAAGCTGGAAGTGG - Intergenic
1018288786 6:162269110-162269132 CAGACTCCGGATGCTGGTGCTGG + Intronic
1018673434 6:166198206-166198228 CAGAGTCAGGATGGTGGAGGAGG - Intergenic
1019845070 7:3490761-3490783 CAGTCTCAGGCTATTGGAGGGGG + Intronic
1020008015 7:4792458-4792480 CAGCCTCAGGACTATGGAGGGGG + Intronic
1020748556 7:12110900-12110922 CAGTTTCAGCATGCTGGAGTAGG - Intergenic
1021385244 7:20021524-20021546 CTCTCTCAGGAAGCTAGAGGAGG + Intergenic
1022345465 7:29510065-29510087 CAGTCTCAGGAGCCTGGAAAGGG - Intronic
1022522195 7:31015633-31015655 TTGTGTCAGGGTGCTGGAGGTGG + Intergenic
1022686005 7:32597096-32597118 CAGGCACATGATGCTCGAGGGGG - Intergenic
1023117104 7:36873307-36873329 CACTCTAAGGAGGCTGCAGGGGG + Intronic
1024816227 7:53275220-53275242 CAGCCCCAGGTTGCTGGTGGTGG + Intergenic
1026136090 7:67662328-67662350 AAGTCTGAGGATGAGGGAGGTGG - Intergenic
1026452904 7:70544992-70545014 GCTTCTCAGGATGCTGGATGAGG - Intronic
1026618360 7:71928014-71928036 AAGCCTTAGGATGCTGGAGAAGG - Intronic
1027795252 7:82684620-82684642 TAGTGTCATGGTGCTGGAGGTGG + Intergenic
1028622903 7:92844335-92844357 CTGTCTGAGGATGCTGGACTAGG - Intergenic
1029285192 7:99460898-99460920 TGGTCCCAGGATGCTGGAGGTGG - Intronic
1031923663 7:127619362-127619384 CAGTCTGAGGATGCTGGAGGAGG - Intergenic
1033260536 7:139840332-139840354 CAGTCCCCACATGCTGGAGGCGG - Intronic
1034430269 7:151037777-151037799 CTGTCCCAGGAAGCGGGAGGCGG + Intronic
1034921122 7:155083231-155083253 GAGTCACAGTATGCTGGAGAGGG + Intronic
1035022015 7:155805744-155805766 CCGCCTCCAGATGCTGGAGGTGG + Intronic
1035105558 7:156439558-156439580 CGGACCCAGGAGGCTGGAGGTGG - Intergenic
1035666263 8:1382337-1382359 CAGTCTCAGGGTGGCAGAGGAGG + Intergenic
1036048311 8:5167961-5167983 CAATGTGAGGATGCTGGTGGAGG - Intergenic
1036307293 8:7611528-7611550 CAGTCCCAGGATGGGGGAGGAGG + Intergenic
1036488126 8:9198549-9198571 CAGTCTCTGGCTGTGGGAGGTGG + Intergenic
1036730487 8:11258808-11258830 CAGTCTAAGGGTGCAGGACGTGG - Intergenic
1036768946 8:11565821-11565843 CTGCTCCAGGATGCTGGAGGTGG + Intergenic
1036892814 8:12607431-12607453 CAGTCCCAGGATGGGGGAGGAGG - Intergenic
1037272367 8:17144062-17144084 CAGTGTCAGGCTGAGGGAGGTGG + Intergenic
1037334099 8:17775377-17775399 AAGTTTCAGGATCCCGGAGGTGG - Intronic
1038395219 8:27241533-27241555 CAGTCAGAGGAGGCTGGTGGGGG - Intronic
1038653540 8:29427831-29427853 AACTCTCTGGAGGCTGGAGGCGG + Intergenic
1038746509 8:30259615-30259637 CAGGCGTAGGATGCTGGAGATGG + Intergenic
1038833884 8:31096822-31096844 CAGCCTCAAGTTGCTGGAGCAGG - Exonic
1040595681 8:48835322-48835344 CAGGGTCAGCATGCTCGAGGGGG - Intergenic
1040970024 8:53125607-53125629 CAGCCTCTGGAAGCTGGAAGAGG + Intergenic
1041402180 8:57457500-57457522 CAGTTCCAGGGTGCTGGAGCTGG + Intergenic
1042235830 8:66612885-66612907 CATTCGCCGGAGGCTGGAGGAGG - Exonic
1042898863 8:73701193-73701215 AATTTTCAGGATGCTGGAGTGGG + Intronic
1042993463 8:74666934-74666956 CTGTCTCAGCATGCAGGTGGAGG - Intronic
1047215157 8:122870145-122870167 GAGTCTGAGGTTGCTGGAGCAGG + Intronic
1048264666 8:132974929-132974951 AAATCACAGGATGCTGAAGGTGG - Intronic
1048860884 8:138723932-138723954 AAGGCTCCTGATGCTGGAGGAGG - Intronic
1049125942 8:140787941-140787963 CAGTCACAGGAGTCTGGAGGAGG - Intronic
1049167267 8:141134088-141134110 CAGTTCCAGGATCCAGGAGGAGG + Intronic
1049219503 8:141422487-141422509 CTGTTACAGGATCCTGGAGGAGG + Intronic
1049573321 8:143379523-143379545 CCGTGTCAGGATGCAGGGGGTGG + Intronic
1050451337 9:5784662-5784684 CTGTCTCAGGAAGCTGTAGAAGG - Exonic
1051735109 9:20189913-20189935 CAGTCTAAGGGTGCTGGGAGGGG + Intergenic
1055249449 9:74284747-74284769 CAGTGTCTGGAAGCTGGAAGGGG + Intergenic
1055807755 9:80116166-80116188 GCCTCTCTGGATGCTGGAGGAGG + Intergenic
1056059534 9:82870034-82870056 CAGTCACAGGATGGGGGATGAGG - Intergenic
1056298061 9:85213201-85213223 CTGTCTCAGTATCCAGGAGGAGG + Intergenic
1057040251 9:91842769-91842791 CAGTGACAGGTGGCTGGAGGTGG - Intronic
1057748549 9:97771711-97771733 CAGTAGCAGGAAGTTGGAGGAGG + Intergenic
1058660958 9:107268363-107268385 CTGTCTCAGGATGGCAGAGGTGG - Intergenic
1058675604 9:107397482-107397504 AAGACTCAGCATGCTGGAGGCGG + Intergenic
1060055345 9:120408455-120408477 CCTTCTCAGGGTGCAGGAGGAGG - Exonic
1061397229 9:130349704-130349726 CAGACTCAGCCTGCTGGATGTGG + Intronic
1062185394 9:135215587-135215609 CAGCCTCTGGAAGCTGGAAGCGG + Intergenic
1062571235 9:137186331-137186353 CAGGCTCAGTCTGCTGGAGCGGG - Exonic
1062696863 9:137880080-137880102 TTGTCTCAGGATGCTAGTGGGGG - Intronic
1188769213 X:34131588-34131610 CAGTCTCAGGAGGCTCCGGGCGG + Exonic
1188834884 X:34943716-34943738 CAGTCTCAGGAGGCTCCGGGTGG - Exonic
1189007237 X:37009112-37009134 CAGTCTCTGGAGGCTCCAGGTGG - Exonic
1189007253 X:37009184-37009206 CAGTCTCGGGAGGCTCCAGGTGG - Exonic
1189007380 X:37009796-37009818 CAGTCTCAGGAGGCTCCAGGTGG - Exonic
1189007429 X:37010048-37010070 CAGTCTCAGGAGGCTCTGGGCGG - Exonic
1189007481 X:37010264-37010286 CAGTCTCAGGAGGCTCTGGGCGG - Exonic
1189007533 X:37010480-37010502 CAGTCTCAGGAGGCTCTGGGCGG - Exonic
1189007577 X:37010696-37010718 CAGTCTCAGGAGGCTCCGGGCGG - Exonic
1189040975 X:37542263-37542285 CAGTCTCAGGAGGCCCCAGGCGG + Intronic
1189041005 X:37542407-37542429 CAGTCTCAGGAGGCCCCAGGTGG + Intronic
1189041023 X:37542479-37542501 CAGTCTCGGGAGGCTCCAGGTGG + Intronic
1189041039 X:37542551-37542573 CAGTCTCAGGAGGCTCTGGGTGG + Intronic
1190234024 X:48602247-48602269 CTGTCCCAGTGTGCTGGAGGAGG - Intronic
1190933014 X:54966377-54966399 CAGGCTCAGGATACTGAATGGGG - Intronic
1192549322 X:72041568-72041590 CAGCCTCAGGAGAGTGGAGGGGG + Intergenic
1194861190 X:99000775-99000797 GTGTCTCAGGATGCTGAAGCAGG - Intergenic
1196315707 X:114220734-114220756 CAGTCACCAGATGCTAGAGGAGG - Intergenic
1196458015 X:115903478-115903500 ATGTCTCAGGAGGCTGGTGGTGG - Intergenic
1196915551 X:120531380-120531402 CAGTTTCAGGATGCTGCAGTTGG + Intronic
1199966474 X:152824723-152824745 CTGGCCCAGGAAGCTGGAGGGGG - Intergenic
1200414890 Y:2899404-2899426 CAGTCTCAGTATGTTGGCTGTGG - Intronic
1201400370 Y:13598217-13598239 CAGTTTCAGGATTCTGGAGTTGG - Intergenic