ID: 1093056772

View in Genome Browser
Species Human (GRCh38)
Location 12:14563881-14563903
Sequence CAGTATGTTCATTCTTTACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 254}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093056772_1093056773 -10 Left 1093056772 12:14563881-14563903 CCGTGTAAAGAATGAACATACTG 0: 1
1: 0
2: 2
3: 25
4: 254
Right 1093056773 12:14563894-14563916 GAACATACTGAGCAACTGTGAGG 0: 1
1: 0
2: 2
3: 13
4: 154
1093056772_1093056774 11 Left 1093056772 12:14563881-14563903 CCGTGTAAAGAATGAACATACTG 0: 1
1: 0
2: 2
3: 25
4: 254
Right 1093056774 12:14563915-14563937 GGCCTTATGTCGAATGAATTTGG 0: 1
1: 0
2: 0
3: 1
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093056772 Original CRISPR CAGTATGTTCATTCTTTACA CGG (reversed) Intronic
901571687 1:10166035-10166057 CAGTAGGCTCATTCTTGACCAGG + Intronic
904790546 1:33017114-33017136 CAGTATATCAATTCTTTACATGG - Intronic
904955171 1:34277202-34277224 CAGTATGTTCTTTCTCTTAATGG + Intergenic
905007811 1:34725083-34725105 CATTATATTGATTGTTTACATGG - Intronic
905928159 1:41766836-41766858 GAGACTGTTCATTCTTGACATGG - Intronic
908069562 1:60443353-60443375 CAGTTTCTTCATTTTTCACAAGG - Intergenic
908700703 1:66897411-66897433 CCCTTGGTTCATTCTTTACATGG - Intronic
909153963 1:72046320-72046342 CAATGTGTTCTTTCTTTACTTGG - Intronic
909381237 1:75001173-75001195 CAGTTTGGGCATTCTTTAAAAGG - Intergenic
909648186 1:77940341-77940363 CTGTAGGTACATTCTTTATAGGG - Intronic
910575046 1:88752398-88752420 CAGTAAGTAAAATCTTTACAAGG + Intronic
910813405 1:91261951-91261973 CAGTATGTTAATTTTGTAAAGGG - Intronic
911811560 1:102289025-102289047 AAGTATGTTCCTTCTATACCCGG - Intergenic
912662630 1:111546594-111546616 CAGAATTTTCATCCTTTTCAAGG + Intronic
916227209 1:162500409-162500431 CATTATGTCCTTTTTTTACACGG - Intronic
916664789 1:166956955-166956977 CAGTATTTTCTTTCTTTATCTGG + Intronic
917108315 1:171518110-171518132 CAGTATCTTTATTATTAACAGGG + Intronic
917250287 1:173052087-173052109 AAGAATGTTCATTCTTTTCTAGG - Intergenic
917891608 1:179443726-179443748 CAGAATTTTCTTTCTTTTCAAGG + Intronic
918697834 1:187566115-187566137 CAGTACGTTACTTCTTTACCAGG - Intergenic
919323013 1:196066582-196066604 TAGTATATTCATTTTTTAGATGG - Intergenic
919682546 1:200450275-200450297 CAATATTATCATTATTTACAGGG + Intergenic
921087940 1:211813966-211813988 AAGAATGTTCATACTTGACAAGG - Intronic
921368747 1:214400454-214400476 TAGTATGTTCTTTCTTTAGTGGG - Intronic
921432224 1:215078694-215078716 CAGTATGTCCATTCCTGATATGG - Intronic
921651096 1:217679343-217679365 CAGTTTCTTCATTTTTAACATGG + Intronic
922415335 1:225416783-225416805 CAGTATGATAACTATTTACATGG + Intronic
924450804 1:244177301-244177323 CAGTATTTTCTTTCTGTACCTGG + Intergenic
1063478535 10:6349986-6350008 CAGGATGTCCATTCTTTTCCTGG + Intergenic
1063681925 10:8196511-8196533 CAATTTGTTCATTCTTTTCCAGG - Intergenic
1064775135 10:18768374-18768396 CAGAATGTTCTTTCTTTTTAAGG + Intergenic
1065355525 10:24836752-24836774 CACTATTTTCATTCATTTCAAGG - Intergenic
1065412287 10:25443023-25443045 CAGTATGGTCATGGTTGACATGG + Intronic
1067841581 10:49684132-49684154 CAGTCAGTTGATTCTTGACATGG - Intronic
1067994245 10:51252750-51252772 CAGTTTCTTCATTCTTTAAATGG + Intronic
1068675172 10:59763060-59763082 CAGTCTCTTGACTCTTTACAGGG + Intergenic
1068777284 10:60881606-60881628 CAGTCTCTTCATCCGTTACATGG + Intronic
1072735715 10:97878028-97878050 CACTTTGTTCATTTTTTAAAAGG + Intronic
1073838956 10:107476276-107476298 AAATATGTTCAATCTTTACATGG + Intergenic
1073929406 10:108556468-108556490 CAGAAGGTACATTCTTCACAGGG - Intergenic
1074201866 10:111244632-111244654 CATTATTTTATTTCTTTACATGG - Intergenic
1074321164 10:112403975-112403997 TATTATATTCATTCTATACATGG + Intronic
1074625781 10:115184566-115184588 AAGTATGTTGGTTATTTACAAGG + Intronic
1077199678 11:1299669-1299691 CAGTATGTGCATCTTGTACATGG - Intronic
1078307105 11:10200230-10200252 TAGTATCTTCATTTTTTATATGG - Intronic
1080479727 11:32634020-32634042 CAGTATTTAAATTATTTACAGGG - Intronic
1080540632 11:33260961-33260983 CAGTGTGTTTATTTTTTAAAAGG + Intronic
1080561633 11:33468825-33468847 CAGTATCTTCATTCCTCCCAGGG - Intergenic
1081284228 11:41247654-41247676 CATTATGTTCACTTTTTAGAAGG + Intronic
1082979797 11:59108926-59108948 TAGTATGTTCATATTTTACATGG + Intronic
1083276965 11:61602349-61602371 CAGTGTGTTCCTTCTTTAGAAGG + Intergenic
1085226650 11:74927328-74927350 CTCTATGCTCATTCCTTACAGGG + Intronic
1085881105 11:80466860-80466882 CAGTATGGTGATTCTTCAAAGGG + Intergenic
1086062957 11:82719029-82719051 CACTATCTTCATTCTATAGAGGG + Intergenic
1089062243 11:115634807-115634829 CAGTATGGTAATTCTTTCCAAGG - Intergenic
1089420294 11:118327494-118327516 CAGTATAATAATTATTTACATGG + Intergenic
1089897242 11:121943249-121943271 CAGTAAATTTTTTCTTTACAGGG + Intergenic
1090634337 11:128680942-128680964 CTGTCTGATCATTCTTTCCATGG + Intergenic
1091072479 11:132581050-132581072 CAGCATTTTCAGTCTTTAAAAGG + Intronic
1091268943 11:134292261-134292283 CAGTGTGTTCAAGATTTACACGG - Intronic
1093056772 12:14563881-14563903 CAGTATGTTCATTCTTTACACGG - Intronic
1094766751 12:33605035-33605057 CAGAATGTACATTCCTTTCAAGG + Intergenic
1094866376 12:34536420-34536442 CAGCATGTTCATTCTGTGAATGG - Intergenic
1095497097 12:42796577-42796599 CAGAATGTACATTCTTCTCAAGG + Intergenic
1097100106 12:56581812-56581834 CACTGTGTTCTTTCTTTATAGGG + Exonic
1097644048 12:62214733-62214755 CAGCAGGTTCATTTTTTCCAAGG - Intronic
1098930584 12:76407922-76407944 CAGTTTGTTCATTCATAAAATGG + Intronic
1101279639 12:103239180-103239202 CAGTATTTTAAGTCTTTACATGG - Intronic
1101586283 12:106088671-106088693 CAGTTTGTTCAATGTTTACAAGG + Intronic
1104344288 12:127982011-127982033 CAGCATGTTAATTTTTTACTAGG - Intergenic
1105693920 13:22869932-22869954 CAGTATCTTCATTCTTAAGAAGG + Intergenic
1107042664 13:35966451-35966473 CAGAATTTTCATTCTTTTTAAGG - Intronic
1107847915 13:44537091-44537113 CAGTAAGTGCATTTTTTTCATGG + Intronic
1108115604 13:47124233-47124255 CAGAATGTTGATTCTTAACAAGG - Intergenic
1108918060 13:55640885-55640907 CAAAATTTTTATTCTTTACAGGG - Intergenic
1108929402 13:55797519-55797541 CAGAATATGCATTCTTTTCATGG - Intergenic
1108982505 13:56535975-56535997 CAGTATGTACTTTTTTTACTTGG + Intergenic
1109335390 13:60987381-60987403 CAGTTTGATCATTATTAACAAGG + Intergenic
1109490231 13:63088146-63088168 TTGTATGTTCAGTTTTTACAGGG - Intergenic
1110026040 13:70540529-70540551 TTTTATGTTCATTCTTTGCAGGG - Intergenic
1110256576 13:73440226-73440248 CAGGAAGTTCACTCTCTACACGG + Intergenic
1110883331 13:80600790-80600812 CAGTATGTGCTTTCCTTAGATGG + Intergenic
1115370322 14:32606248-32606270 CAGTATGTTCAATTTTTTAATGG + Intronic
1115901503 14:38155776-38155798 CATTATGTTTATTATTTATAAGG + Intergenic
1116965044 14:51005420-51005442 CAGTTTGTTCATTCTGAACCAGG - Intronic
1117228623 14:53691498-53691520 CAGTATGTTTATCCATTACTCGG - Intergenic
1117319787 14:54610318-54610340 GACTTTGTTCCTTCTTTACATGG - Intronic
1119273177 14:73327971-73327993 CAATATGATAATTCTTTAAAAGG - Intronic
1120638132 14:86976638-86976660 CAGAATGTACATTCTTCTCATGG + Intergenic
1121591813 14:95120419-95120441 CAGTATGTTCATTCGTAAAATGG - Intronic
1123883943 15:24704826-24704848 CTGTATCTTGATTCTTTACCTGG + Intergenic
1124635357 15:31361459-31361481 CTGCATGTACACTCTTTACAGGG - Intronic
1127231308 15:56998728-56998750 CAGAATATACATTCTTTCCAAGG + Intronic
1127709427 15:61580803-61580825 TTGTATTTTCATTCTTAACAAGG + Intergenic
1128903352 15:71445496-71445518 CCATATGTTCATTCTTCACCAGG + Intronic
1128961596 15:72012127-72012149 CAATATTTTTATTCTCTACATGG + Intronic
1129591742 15:76921181-76921203 CTAGATGTTCATTCTTTACCAGG + Intergenic
1129798899 15:78398624-78398646 CAGGATTCTCATTCTTTCCAGGG + Intergenic
1132919158 16:2375256-2375278 CAGTTTCTTCATTGTTTTCATGG + Intergenic
1134890071 16:17833311-17833333 CAGTAAATTCATTCATTATATGG + Intergenic
1136647933 16:31638952-31638974 CAGAATATACATTCTTCACATGG - Intergenic
1136740295 16:32514906-32514928 CAGTATGCTCATTCATCTCACGG - Intergenic
1137345800 16:47657987-47658009 CAGTCTGTTCATGCTCTACCTGG + Intronic
1138103357 16:54272355-54272377 CAGTGTATCCAATCTTTACAAGG - Intergenic
1139861295 16:70023944-70023966 CAGTTTTATCATTCTTTACTTGG + Intergenic
1203029320 16_KI270728v1_random:560334-560356 CAGTATGCTCATTCATCTCACGG + Intergenic
1203042401 16_KI270728v1_random:774097-774119 CAGTATGCTCATTCATCTCACGG - Intergenic
1144722830 17:17484268-17484290 CAATGTTTTAATTCTTTACAAGG + Intronic
1145353109 17:22106441-22106463 TAGTATTTTTATTCTTCACAGGG + Intergenic
1147497548 17:40931352-40931374 AAGTAAGTTCCTTCTTCACAGGG - Exonic
1149215956 17:54354575-54354597 CAGAATATACATTCTTTTCAAGG - Intergenic
1154416106 18:14176813-14176835 CAGTATGTTTCTTCTGTACCTGG - Intergenic
1154973265 18:21431569-21431591 CAGAATATACATTCTTTTCAAGG - Intronic
1156202100 18:34845188-34845210 CAGTATGTTCAAATTATACAAGG - Intronic
1156513718 18:37662290-37662312 GAGTAAGTTAATTCTTCACATGG + Intergenic
1157122351 18:44923354-44923376 CAGTTTGTTCATTAGTTAAATGG - Intronic
1157720993 18:49924356-49924378 GAGTATGATCATTCTTTTTAAGG + Intronic
1158480297 18:57815942-57815964 CACTATATTCTTTCTTTAAAAGG - Intergenic
1159468144 18:68812784-68812806 CTGTATGTTAATTCTTCAGAAGG - Intronic
1161874234 19:6895221-6895243 GAGTATGCTCTTTCTTTTCAAGG + Intronic
1161874947 19:6901104-6901126 GAGTATGCTCTTTCTTTTCAAGG + Intronic
1163679098 19:18670414-18670436 TAGGAGGTTAATTCTTTACATGG - Exonic
1164738986 19:30562899-30562921 CAGTATGCTCTGTCTCTACATGG + Intronic
1165563793 19:36705622-36705644 CAGAATATGCATTCTTTACAAGG - Intronic
1168593513 19:57655380-57655402 CTGTATGTTCATTCTAACCAAGG + Intergenic
925626454 2:5846393-5846415 CAGTCTGTACATTTTTTACTGGG - Intergenic
926176577 2:10597881-10597903 CAGCTTGGTAATTCTTTACAGGG + Intronic
926948786 2:18218520-18218542 AAGTATGGGCATTCATTACACGG - Intronic
926975226 2:18509169-18509191 CAGTATAATCATTTTTTAAAAGG + Intergenic
928268640 2:29834255-29834277 CAGTATGTTTATTGTCTACATGG + Intronic
929279189 2:40059772-40059794 GAGAATGTTCATTTTTAACAAGG - Intergenic
929416816 2:41751363-41751385 CAATATGTTGATTCTTTACAGGG + Intergenic
931936546 2:67203714-67203736 CAAAATGTTCCTTCTTAACAAGG + Intergenic
937058610 2:118963541-118963563 CAGAATGTACATCCTTTTCAAGG - Intronic
937739180 2:125329469-125329491 CAGCATGTTCATCTTTTAAATGG - Intergenic
938419318 2:131131537-131131559 CAGAGTTTTCATTCTTTAGATGG + Intronic
939707488 2:145473116-145473138 CAGTAAATTCATTTTTGACAAGG - Intergenic
939718687 2:145618771-145618793 CTATATGTTCACTCTTTACTTGG + Intergenic
942713329 2:178863236-178863258 CAGTATGTTCATTTTTCAGATGG - Intronic
943529466 2:189061155-189061177 CAGTATGTACATTATTTAATAGG - Intronic
943633683 2:190281637-190281659 AAGTTTTTTCACTCTTTACATGG + Intronic
943884237 2:193193121-193193143 CAGTTTGTCAATTCCTTACAAGG - Intergenic
945208896 2:207361721-207361743 CAGTCTGGTCATTCCTTAAAAGG - Intergenic
945649768 2:212542468-212542490 CAGTAGCTTCATTCTTACCACGG - Intergenic
946265498 2:218537806-218537828 CAGCATGGTCTTGCTTTACAAGG - Intronic
1169809938 20:9599408-9599430 CAGTTTGTTGATTCTTCAGAAGG - Intronic
1170683689 20:18549371-18549393 CAGTATGACAATTATTTACATGG - Intronic
1171563347 20:26150639-26150661 TAGTATTTTTATTCTTCACAGGG + Intergenic
1176867372 21:14061748-14061770 CAGTATGTTTCTTCTGTACCTGG - Intergenic
1176915455 21:14620386-14620408 CAGAATGTACCTTCTTCACATGG - Intronic
1177258992 21:18704001-18704023 CAGTATGGTAAGTATTTACATGG - Intergenic
1177323946 21:19558616-19558638 CAGAATATACATTCTTTTCAAGG - Intergenic
1178061336 21:28856467-28856489 CAGATTTTTCATTCATTACATGG - Intergenic
1183013725 22:34969010-34969032 CAGTTTGTTCATCCTTAAAAAGG - Intergenic
1184558386 22:45246475-45246497 AAGTATGTTAATGATTTACAAGG - Intergenic
1184613350 22:45620819-45620841 AAGCATGTACCTTCTTTACAAGG + Intergenic
952647337 3:35676723-35676745 TAGTATGTGCATTCTATTCATGG + Intronic
953240684 3:41146607-41146629 AAGTATTTTCATTTTTAACATGG - Intergenic
953763046 3:45708602-45708624 CAATATCTTCATTCTCTACTAGG + Intronic
954505230 3:51064480-51064502 CAATAAGTTCATTCATCACATGG - Exonic
956041300 3:65148167-65148189 CCATATATTCATTCTTTAAATGG + Intergenic
956085277 3:65601821-65601843 CAGTATTTTTTTTCTTTCCATGG - Intronic
957806164 3:85152314-85152336 CAGTAGGTGCCTTCGTTACAAGG + Intronic
957921264 3:86751338-86751360 CTTTATTTTCATTCTTTATATGG + Intergenic
959980408 3:112510043-112510065 CTGTATTTCCTTTCTTTACATGG - Intergenic
960144265 3:114182826-114182848 CAGAATTTTCTTTCTTTTCAAGG + Intronic
963910302 3:150811641-150811663 CAGTATGTACAATCTTGAGATGG + Intergenic
964891492 3:161541370-161541392 AAGCTTCTTCATTCTTTACATGG + Intergenic
966048246 3:175579834-175579856 CAGTATTTTTATTCTCTACAGGG + Intronic
966513872 3:180795290-180795312 AGGTATGTTCCTTCTATACACGG + Intronic
966528831 3:180950829-180950851 CATTATGTTCATTCATTAATTGG + Intronic
967258403 3:187617253-187617275 CAGGATTTTCATTCTTGGCATGG + Intergenic
969253390 4:5986185-5986207 AACAATGTTCATTCTTTACAAGG + Intronic
971173187 4:24255013-24255035 AAATATGCTCAGTCTTTACAAGG - Intergenic
971206532 4:24575294-24575316 CGGTATGTTCAATCTCTGCATGG + Intronic
971327767 4:25658117-25658139 CAGTATCCTCATTCTATAGAGGG - Intronic
972709034 4:41575170-41575192 CAGTGTCTTCATACTTAACATGG - Intronic
972859400 4:43148984-43149006 CAGAATATTCATTTTTTCCAGGG + Intergenic
974566071 4:63579509-63579531 GAGTATGTTGACTCTTTTCATGG + Intergenic
976384603 4:84441348-84441370 CATTATGGTGATTCTTTACAGGG + Intergenic
977257461 4:94757415-94757437 TAATGTGTTCATTTTTTACAAGG + Intergenic
977484797 4:97629685-97629707 AAGTATTTTCCTTCTTTTCAAGG - Intronic
978511167 4:109520087-109520109 CAGTATATTCAATCTTTTCTTGG + Intronic
979627810 4:122865762-122865784 CAGAATCTACATTCTTTTCAAGG - Intronic
981054307 4:140344635-140344657 GAGTATTTTCAGTCTTTATAAGG + Intronic
981141400 4:141273614-141273636 CAGTTTTTTCATTATTTATATGG + Intergenic
984105634 4:175541777-175541799 AATTATGTTCATTCTTTAATAGG - Intergenic
984272224 4:177560684-177560706 CAATATGTTAATTCTTTTCTTGG + Intergenic
984742485 4:183179296-183179318 CAGTATTTTAATACTTTACAAGG + Intronic
984861157 4:184240558-184240580 CAGAATGTCCATTCTTCTCAAGG - Intergenic
985321473 4:188716518-188716540 CAGTATGTTCATCTATAACATGG - Intergenic
986131438 5:4935811-4935833 CAGAATGTTCTTTGTTTTCAAGG - Intergenic
987186336 5:15423965-15423987 AAGCAGGTGCATTCTTTACAAGG - Intergenic
987328813 5:16836779-16836801 CAGTCTGGTCATTCTTTGAAAGG + Intronic
987959556 5:24787655-24787677 AAGAATATTCATTCTTTTCAAGG + Intergenic
988159937 5:27505850-27505872 CAGAGTGTTTATTCTATACATGG + Intergenic
988543025 5:32129396-32129418 CAGAATGTTTATTCTGCACATGG - Intronic
989772680 5:45163379-45163401 CAGTTTGGTCAGTCTTTAAAGGG + Intergenic
990206795 5:53438404-53438426 AAGTATGTGCAATCTTTACGTGG + Intergenic
991547103 5:67795044-67795066 ATGTATTTTCACTCTTTACATGG - Intergenic
992535030 5:77691658-77691680 CATTCTGTTCCTTCTTTACAAGG + Intronic
993014954 5:82524863-82524885 CAGTTTCTTCATTGCTTACATGG + Intergenic
994941056 5:106324742-106324764 AAGTATTTTTATTCTTTACCAGG + Intergenic
994957170 5:106546834-106546856 CAGGCTCTTCATTGTTTACAAGG - Intergenic
994989141 5:106977059-106977081 CAGTATTTGCATTCTTTCTAAGG - Intergenic
995513479 5:112930805-112930827 CAATATGTTCATTCTTTCCAGGG - Intergenic
997741489 5:136258775-136258797 AAGTATGTACATTCTTTAAATGG + Intronic
998809924 5:145956068-145956090 CAGAATGTACATTTTTAACAGGG - Intronic
999089996 5:148927580-148927602 CAGAATTTTCTTTCTGTACAGGG + Intronic
1000157851 5:158569398-158569420 CAGAATTTTCATTTTTTACTAGG - Intergenic
1000518292 5:162267671-162267693 CAATATTTTCATTGTTAACATGG + Intergenic
1003012009 6:2435192-2435214 AAATATGTTCATTCTTTGAAAGG - Intergenic
1003535512 6:6972246-6972268 CAATATGGTCATTGTTTAGATGG + Intergenic
1003658793 6:8041193-8041215 GAGTATGTTCATTTGTTTCATGG + Exonic
1005150924 6:22749577-22749599 CAGTCTGTTCCTTCTTCACATGG + Intergenic
1009264973 6:61542695-61542717 CAGAGTGTTTATTATTTACAAGG + Intergenic
1009948799 6:70370543-70370565 TAATGTGTTCATTCTTAACAGGG - Intergenic
1011403943 6:86996160-86996182 CAGAATAATCATTCTTTTCAAGG + Intronic
1012311751 6:97734040-97734062 AAGTATGATTATTCCTTACACGG - Intergenic
1013335817 6:109159608-109159630 CAGTATTTTTATTCTTTATCAGG + Intronic
1014178625 6:118358464-118358486 CAGAATATACATTCTTTTCAAGG + Intergenic
1015573307 6:134644492-134644514 GAGTATGTTCTTTCTTTCCCTGG + Intergenic
1016286198 6:142475928-142475950 CATTATCTTCATGCTTTACAGGG + Intergenic
1016729441 6:147412773-147412795 CAGTATTTTCATTCTGTGCCTGG - Intergenic
1019885255 7:3898829-3898851 CAAGAAGTTCATTCTTTACTAGG + Intronic
1020643243 7:10781149-10781171 CATTATTTTCATTCTTTTTATGG + Intergenic
1021133172 7:16935394-16935416 GAGTATGTGCATTATTCACATGG - Intergenic
1021663238 7:22943379-22943401 CAGAATTTGCATTCTTAACAAGG - Exonic
1023953064 7:44863110-44863132 CAGATTTTTCAGTCTTTACAAGG - Intergenic
1024703651 7:51933004-51933026 CACTATGTTCATTGTTTCCTTGG + Intergenic
1024876789 7:54034872-54034894 CAGGATGTTCATTTCTTACCAGG + Intergenic
1024982724 7:55171244-55171266 CAGTGTGGTCATTCTTGACGAGG - Intronic
1025274367 7:57563730-57563752 TAGTATTTTTATTCTTCACAGGG - Intergenic
1025530183 7:61870311-61870333 CAGTATGCTCATTCATCTCACGG - Intergenic
1026377458 7:69766277-69766299 CAGTATGTTCTTCCTTTTTAAGG + Intronic
1026714169 7:72772308-72772330 CAGAATTTACATTCTTTTCATGG + Intronic
1031332317 7:120481413-120481435 CAGCCTTTTCATTCTTTACATGG - Intronic
1031466777 7:122122846-122122868 CAGTATGTTCACGTTTTAAATGG - Intronic
1031670167 7:124532920-124532942 CACTATGTTAATTTTTTTCAGGG + Intergenic
1033994299 7:147326365-147326387 CAGAATTTTGATTCTTTTCATGG + Intronic
1036447398 8:8833805-8833827 CAGTATGTTCATTCATTTGATGG - Intronic
1037713985 8:21381299-21381321 TAGTGTGAGCATTCTTTACATGG - Intergenic
1038164901 8:25076376-25076398 TAATGTGTTCATTGTTTACAAGG + Intergenic
1039448455 8:37651183-37651205 GTGAAAGTTCATTCTTTACATGG + Intergenic
1039558090 8:38491268-38491290 CAGTCTGTGCATTCAGTACAGGG - Intergenic
1044190055 8:89305145-89305167 CCATATGTTCATTCTTCACGGGG - Intergenic
1044635047 8:94314871-94314893 AAGTATGTTCCTTCTATACCCGG + Intergenic
1046716452 8:117573080-117573102 CAGTTTGTTCATCCTTAAAATGG + Intergenic
1047064774 8:121268852-121268874 ATCTATGTTCTTTCTTTACAAGG + Intergenic
1049193451 8:141302060-141302082 CAATTTGTTCATTTTTTAAAAGG + Intronic
1050117180 9:2275109-2275131 CAGTTTTTTCATTTTTAACATGG - Intergenic
1051889657 9:21928913-21928935 CAGTATGTTTCTTCTTTAGCAGG + Intronic
1052869485 9:33489810-33489832 AAGTATCTTCATTATATACATGG + Intergenic
1053332281 9:37224112-37224134 CAGTATATTAATTTTTTAAAAGG + Intronic
1053717543 9:40911967-40911989 CTGAATGTTTATTCCTTACAGGG + Intergenic
1055429918 9:76233037-76233059 CAGCATGCTCATGCTTTGCAAGG - Intronic
1056184642 9:84121547-84121569 CATTAGGCTCATTCTTTTCAGGG - Intergenic
1057034689 9:91803225-91803247 CAGAATTTTCTTTCTTTTCAAGG - Intronic
1057688913 9:97265275-97265297 AAGTATCTTCATTATATACATGG - Intergenic
1058784346 9:108372191-108372213 CAGAATATACATTCTTTTCATGG - Intergenic
1059616003 9:115951358-115951380 CATTATGTCCTTTCTCTACAAGG - Intergenic
1059743868 9:117181471-117181493 CAGTGACTTCATTCTGTACATGG + Intronic
1062204423 9:135328196-135328218 CTCTTTGTTCATACTTTACAGGG - Intergenic
1187962522 X:24580189-24580211 CAAAATGTTCATTTTCTACATGG - Intronic
1188825557 X:34828796-34828818 CAGTGTGTTCATATTTTATATGG - Intergenic
1189254183 X:39624476-39624498 CACCCTTTTCATTCTTTACACGG + Intergenic
1189882908 X:45510643-45510665 CAGTTTCCACATTCTTTACAAGG - Intergenic
1190944637 X:55079574-55079596 AAGTATGTTCCTTCTTTCCCCGG + Intergenic
1190945880 X:55093507-55093529 AAGTATGTTCCTTCTTTCCCCGG + Intronic
1190964427 X:55284888-55284910 GAGTATGTTCCTTCTTTCCCCGG + Intronic
1191965709 X:66755337-66755359 CACTGTGTTAATTTTTTACAAGG - Intergenic
1193293099 X:79801358-79801380 AAGTATGTTCATTCTATTCCAGG + Intergenic
1193587209 X:83339990-83340012 CTGTATTTTGAGTCTTTACATGG - Intergenic
1194080068 X:89451362-89451384 AATTATGTTCATTTTTTAAAAGG - Intergenic
1194695293 X:97041085-97041107 CAGTGTAATCATTCCTTACATGG + Intronic
1196403654 X:115342168-115342190 CAGTATGTTGTTTCTCTAAATGG + Intergenic
1196801480 X:119547218-119547240 GAGTTACTTCATTCTTTACAAGG + Intronic
1198069059 X:133129919-133129941 CAGAGTTTTCATTCTTTACAAGG + Intergenic
1198997789 X:142594962-142594984 CAGCATGTTCTTTATTGACATGG + Intergenic
1200312317 X:155090130-155090152 CAGTTTGTTCATTCATAAAATGG - Intronic
1200432748 Y:3107422-3107444 AATTATGTTCATTTTTTAAAAGG - Intergenic
1200779581 Y:7202204-7202226 CAGTATCTTCATACTAGACATGG - Intergenic