ID: 1093058424

View in Genome Browser
Species Human (GRCh38)
Location 12:14578297-14578319
Sequence ATGGGTGAAGAGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2010
Summary {0: 1, 1: 0, 2: 7, 3: 244, 4: 1758}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093058424 Original CRISPR ATGGGTGAAGAGAAGGAGGA AGG Intergenic
Too many off-targets to display for this crispr