ID: 1093062352

View in Genome Browser
Species Human (GRCh38)
Location 12:14620403-14620425
Sequence GCTTCAATGGGCAAGGTGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 241}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093062352_1093062358 -5 Left 1093062352 12:14620403-14620425 CCGCCCACCTTGCCCATTGAAGC 0: 1
1: 0
2: 0
3: 17
4: 241
Right 1093062358 12:14620421-14620443 GAAGCTCTCTGAACCTCTTCTGG 0: 2
1: 18
2: 65
3: 178
4: 407
1093062352_1093062360 4 Left 1093062352 12:14620403-14620425 CCGCCCACCTTGCCCATTGAAGC 0: 1
1: 0
2: 0
3: 17
4: 241
Right 1093062360 12:14620430-14620452 TGAACCTCTTCTGGTTTTAAGGG 0: 1
1: 2
2: 12
3: 62
4: 310
1093062352_1093062359 3 Left 1093062352 12:14620403-14620425 CCGCCCACCTTGCCCATTGAAGC 0: 1
1: 0
2: 0
3: 17
4: 241
Right 1093062359 12:14620429-14620451 CTGAACCTCTTCTGGTTTTAAGG 0: 1
1: 2
2: 22
3: 140
4: 376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093062352 Original CRISPR GCTTCAATGGGCAAGGTGGG CGG (reversed) Intronic
900312759 1:2042305-2042327 GCTGCCAGGGCCAAGGTGGGGGG - Intergenic
900318804 1:2072495-2072517 GTTTCCATGGGAAAGGTGTGGGG + Intronic
902775419 1:18671501-18671523 GCCCCAGTGGGCCAGGTGGGAGG + Intronic
902835581 1:19044753-19044775 GCCTCAGTGAGAAAGGTGGGTGG + Intergenic
904319709 1:29689107-29689129 CCTTCAATGGCCAAAGTAGGGGG + Intergenic
904772422 1:32887579-32887601 GCTTGGATGGGCTTGGTGGGGGG + Intronic
907095927 1:51780796-51780818 GCTTCAAGGGGAAGGGTGGGAGG + Intronic
908247302 1:62238034-62238056 GGTTCAAGGTGCAAGGTGAGGGG - Exonic
909006189 1:70279096-70279118 ACTTGAAGGGCCAAGGTGGGAGG + Intronic
911803907 1:102180576-102180598 GCTTGGGTGGCCAAGGTGGGCGG - Intergenic
916293571 1:163191976-163191998 GCATCAAGGGGCTAGGAGGGTGG + Intronic
918174892 1:182035208-182035230 GATTCAATCTGTAAGGTGGGGGG - Intergenic
918427531 1:184425715-184425737 GCTTGAAAGGGCAAGGTCAGAGG + Intronic
920796601 1:209143294-209143316 GCCTAAATGGGGATGGTGGGAGG - Intergenic
921106606 1:211987051-211987073 CTTTGAAAGGGCAAGGTGGGTGG + Intronic
921112944 1:212056132-212056154 GCAGCAGTGGGCCAGGTGGGTGG - Intronic
921950676 1:220926775-220926797 GCATCAATGGGGAAGGTGGCAGG + Intergenic
923772248 1:236947919-236947941 GCTGCTCTTGGCAAGGTGGGTGG + Intergenic
923929182 1:238674124-238674146 CCTTCTATGGTCAAGGTCGGAGG + Intergenic
1069274813 10:66576477-66576499 GCTTCATTGGGGAGGGTGGTGGG - Intronic
1069756727 10:70778204-70778226 GCAGCAATGGGAAAGGTGAGGGG - Intronic
1072067596 10:91885865-91885887 GCATCATAGGGCAAGGGGGGTGG - Intergenic
1073079171 10:100846924-100846946 GGTTTGATGGCCAAGGTGGGCGG + Intergenic
1073150675 10:101309420-101309442 AGGTCAATGGGCAAGGTGGGGGG + Intergenic
1075059792 10:119248118-119248140 CCTTCAGAGGCCAAGGTGGGAGG - Intronic
1077448470 11:2617232-2617254 GTTACCATGGGCAAGGTGTGGGG - Intronic
1078426302 11:11253796-11253818 GACTCAATGGGAAAGGAGGGTGG + Intergenic
1081028057 11:38040384-38040406 GCTTGGGAGGGCAAGGTGGGAGG - Intergenic
1083694710 11:64434862-64434884 CCTTGAATGGGCAAGGTGAGCGG - Intergenic
1084493312 11:69489831-69489853 GCTACAGAGGGCAAGGTGGAAGG - Intergenic
1085278541 11:75315308-75315330 GGGTCAATGGGCAAGTTAGGTGG - Intronic
1087174416 11:95082924-95082946 TCTGCACTGGGCAAGGTGAGGGG + Intergenic
1088611907 11:111585494-111585516 GCTTCTATGGGCAAGGAGCCAGG - Intergenic
1089670514 11:120053849-120053871 GATTCTATGGGCAAGGAAGGAGG + Intergenic
1089905268 11:122031720-122031742 GCTTGAGTGGGGAGGGTGGGTGG + Intergenic
1090446576 11:126769725-126769747 GCTTCCAGGGGCAAGGTGGAGGG + Intronic
1090801989 11:130178808-130178830 GGGTCAAAGGGAAAGGTGGGCGG + Intronic
1092758009 12:11783101-11783123 GATTGATTGGGCAAGGTGAGTGG + Intronic
1093062352 12:14620403-14620425 GCTTCAATGGGCAAGGTGGGCGG - Intronic
1093291169 12:17323503-17323525 GTTTCAATGGGCAAGATGCTTGG - Intergenic
1096161592 12:49382946-49382968 GTTTGAAAGGCCAAGGTGGGTGG - Intronic
1096246291 12:49989481-49989503 GCTCCACTGGACAAGGTTGGGGG + Exonic
1097166658 12:57089672-57089694 GCATCAGTGCGGAAGGTGGGGGG + Intronic
1100472482 12:94905812-94905834 GCTCTAATGGGCAAGCTGGATGG + Intronic
1102566792 12:113802353-113802375 ACTTCAATGGGGGAGGTGGAGGG + Intergenic
1103080982 12:118023741-118023763 CCTTCTATGGGCAGGGAGGGCGG - Intronic
1103842335 12:123875351-123875373 GCTGCAATGGGAAAGGCTGGAGG + Exonic
1105977117 13:25482006-25482028 TCTTTAATGGGAAGGGTGGGTGG - Intronic
1106230450 13:27817243-27817265 GCTTTATTGGCCATGGTGGGTGG + Intergenic
1106279956 13:28258060-28258082 ACTTCAGAGGCCAAGGTGGGCGG - Intronic
1107936060 13:45346235-45346257 CTTTCAAAGGCCAAGGTGGGTGG - Intergenic
1108580303 13:51822592-51822614 GCTTCCAGGGGCCAGGTGGCAGG + Intergenic
1108988402 13:56623325-56623347 GCAGCAATGGGCTAGGTAGGTGG - Intergenic
1109056358 13:57554240-57554262 GTTTCATAGGTCAAGGTGGGAGG - Intergenic
1109631921 13:65061052-65061074 GACTCAAGGGGCAGGGTGGGAGG + Intergenic
1109632085 13:65062661-65062683 GACTCAAGGGGCAGGGTGGGAGG - Intergenic
1112328641 13:98460508-98460530 GCTTCCATAGTCCAGGTGGGAGG - Intronic
1112402244 13:99086836-99086858 CCCTCACTGGGGAAGGTGGGGGG + Intergenic
1112845100 13:103632667-103632689 GCTTCACTGAAGAAGGTGGGAGG + Intergenic
1114256038 14:21002052-21002074 ACTACAGTGGGTAAGGTGGGAGG - Intergenic
1114410632 14:22497284-22497306 GGTTCAAGGGTGAAGGTGGGGGG - Intergenic
1116491097 14:45503959-45503981 GCTCCACTGGACAAGGTTGGGGG - Intergenic
1117480623 14:56140798-56140820 GATCTAATGGGCAAGTTGGGGGG + Intronic
1117640440 14:57792766-57792788 GACTCAAGGGGAAAGGTGGGAGG + Intronic
1118325842 14:64779849-64779871 CCTTCAATGGGAGAGGAGGGAGG - Exonic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1119543803 14:75457536-75457558 GTTTCAATGGGGAAGGTATGAGG + Intronic
1120755386 14:88238981-88239003 TCTTCAAAGGGCATGGTTGGTGG + Intronic
1124026592 15:25972588-25972610 GCTTAAAAGGCCAAGGAGGGTGG + Intergenic
1124721573 15:32115341-32115363 GCTGAAATTGGCAATGTGGGAGG + Intronic
1125399340 15:39283478-39283500 GCTAGAAGGAGCAAGGTGGGTGG - Intergenic
1128861934 15:71081449-71081471 GCAGCAGTGGACAAGGTGGGTGG + Intergenic
1132334447 15:101037112-101037134 GCATCAGTGGGCCAGGTAGGTGG + Intronic
1133030906 16:3010697-3010719 GCTTAAGAGGCCAAGGTGGGAGG - Intergenic
1136648374 16:31643389-31643411 ACTTGAATGTGGAAGGTGGGAGG - Intergenic
1137506908 16:49062014-49062036 GCTTGAGTGGGGAGGGTGGGAGG - Intergenic
1139470959 16:67178002-67178024 ACCTCACTGGGCAAGGTGAGGGG - Exonic
1139946741 16:70647159-70647181 GCTCCGACGGGCAAGCTGGGTGG + Intronic
1141656692 16:85420504-85420526 GCTTCCAGGGCCAAGGGGGGTGG + Intergenic
1141949009 16:87328816-87328838 GCTTGATTGGGGAAGGTGGCAGG - Exonic
1142628325 17:1206642-1206664 TCTTGAATGGCCAAGGTGGGTGG + Intronic
1143139674 17:4734406-4734428 CCTTCAGAGGCCAAGGTGGGAGG + Exonic
1143714398 17:8756580-8756602 CTTTCACTGGGCAAGGAGGGAGG + Intronic
1143830101 17:9644859-9644881 GCTTTAATCGGCAAGGAAGGGGG - Intronic
1144218159 17:13075168-13075190 GCGTGAGTGGCCAAGGTGGGTGG + Intergenic
1144804979 17:17959030-17959052 GATTCATCGGGCAAGGTGTGGGG - Intronic
1145236204 17:21210040-21210062 TCTTCAATGAGCGAGGTGCGGGG - Intronic
1146861316 17:36301685-36301707 GCTTCTAGGGGCAGGGTGTGGGG + Intronic
1147091648 17:38105789-38105811 GCTTCTAGGGGCAGGGTGTGGGG + Intergenic
1147105564 17:38214716-38214738 GCTTCTAGGGGCAGGGTGTGGGG - Intergenic
1148337057 17:46849064-46849086 GCCTCCATGGGCAAGCTGGAAGG + Intronic
1148605399 17:48925474-48925496 GCTTAAATGAGACAGGTGGGTGG - Intronic
1149727240 17:58908681-58908703 CCTTGAAAGGCCAAGGTGGGCGG - Intronic
1150497903 17:65623220-65623242 TCCTCAATGGTGAAGGTGGGTGG + Intronic
1151130270 17:71889602-71889624 GCTTCAGTGGGCCAGGTGTGGGG - Intergenic
1151571027 17:74925399-74925421 GGATCAATGGGGAGGGTGGGAGG - Intronic
1152108629 17:78344684-78344706 GCTTCCACAGGCAAGGGGGGTGG - Intergenic
1152863450 17:82709199-82709221 GGGTCAGTGGGCAGGGTGGGTGG - Intergenic
1153354800 18:4123142-4123164 GCATCAACGGACAAGATGGGAGG + Intronic
1153960503 18:10136099-10136121 GCTTCAAAGGGAAAGGAGGATGG + Intergenic
1154222985 18:12473208-12473230 GCTATAATGAGCCAGGTGGGTGG - Intronic
1155637274 18:27970870-27970892 GCATCAATGGGCATGGTGCATGG + Intronic
1156135544 18:34032693-34032715 GCAGCAGTGGGCCAGGTGGGTGG - Intronic
1157450071 18:47779651-47779673 GGTGCAGTGGCCAAGGTGGGAGG + Intergenic
1161946578 19:7440981-7441003 GGTTTCATGGTCAAGGTGGGAGG - Intronic
1162686210 19:12386573-12386595 CTTTGAATGGCCAAGGTGGGAGG - Intronic
1162828127 19:13266901-13266923 GTTTCAATAGGCAAGCTGGGTGG - Intronic
1166523485 19:43496540-43496562 TCTTGAAAGGCCAAGGTGGGAGG + Intronic
925895994 2:8472697-8472719 GCTTTATTGGCCAAGGTGGAAGG - Intergenic
927170318 2:20363954-20363976 GCTTGAGAGGCCAAGGTGGGCGG + Intergenic
927902780 2:26833296-26833318 GTTTGAAAGGCCAAGGTGGGAGG + Intergenic
928670955 2:33602982-33603004 GGTGCAGTGGCCAAGGTGGGCGG - Intergenic
929438068 2:41943819-41943841 GCTTGAATGGCTGAGGTGGGAGG - Intronic
932217731 2:69977765-69977787 AGTTCAATGGGAAAGTTGGGTGG + Intergenic
932684470 2:73856613-73856635 GCATCCATGGACAAGGTAGGTGG - Intronic
933483500 2:82888031-82888053 GTTTGAAAGGCCAAGGTGGGCGG + Intergenic
935328165 2:101956627-101956649 GCTGCAATGGCCATGGTGGCTGG + Intergenic
936922778 2:117706479-117706501 TCTTCAAGGGGAAAGGAGGGTGG - Intergenic
938422218 2:131154728-131154750 GCTGGAGTGGGCAAGCTGGGAGG - Intronic
939971694 2:148669431-148669453 CTTTGAAAGGGCAAGGTGGGAGG + Intronic
945031807 2:205672074-205672096 GCCCCATTGGGGAAGGTGGGAGG + Intergenic
945489545 2:210438901-210438923 GTTTCACTAGGCAAGGTGTGGGG + Intronic
946085647 2:217168583-217168605 GGTTCCATGGACCAGGTGGGTGG - Intergenic
948323493 2:237091769-237091791 GCTTGAAAGGGCAAGGCGAGGGG + Intronic
948955848 2:241290365-241290387 CCTTGAAAGGCCAAGGTGGGTGG + Intronic
1170347735 20:15405673-15405695 GCTAAAATCTGCAAGGTGGGAGG - Intronic
1170739215 20:19039489-19039511 TCTTGAAAGGCCAAGGTGGGCGG + Intergenic
1171395777 20:24832248-24832270 GCTGCCATGGGGAAGGTGGGAGG - Intergenic
1173897192 20:46560038-46560060 GTGTCATTGGCCAAGGTGGGTGG + Exonic
1175623179 20:60467922-60467944 GCTGCAAGAGTCAAGGTGGGAGG - Intergenic
1177171958 21:17664976-17664998 ACTTCAAAGGCTAAGGTGGGAGG + Intergenic
1181045057 22:20210518-20210540 GGGCCAAGGGGCAAGGTGGGTGG - Intergenic
1181060444 22:20279687-20279709 GCCGCAATGGGGTAGGTGGGAGG + Intronic
1181857023 22:25789161-25789183 GCAGCATTGGGCAAGTTGGGAGG + Intronic
1183028069 22:35081291-35081313 ACTTGAATGAGCAAGGTGTGTGG + Intronic
1183745980 22:39691895-39691917 GATTGAAGGGGCAAAGTGGGCGG - Intergenic
949185936 3:1191459-1191481 GCATCCATGTGCCAGGTGGGTGG + Intronic
950339827 3:12233368-12233390 CCTTCAGAGGCCAAGGTGGGAGG + Intergenic
950677941 3:14565780-14565802 TTTTCTATGGGCCAGGTGGGAGG - Intergenic
950868001 3:16204819-16204841 CCTTCAAAGGGCAGAGTGGGAGG - Intronic
953455904 3:43042223-43042245 GTTTGAGTGGGCCAGGTGGGAGG + Intronic
954320513 3:49829476-49829498 GCTTCGATGGGCTCGGTGGCCGG - Exonic
954640064 3:52092520-52092542 GCTGCCATGTGCCAGGTGGGAGG + Intronic
954696337 3:52429204-52429226 GCCTCTATGGGCAGGGTGGGAGG + Intergenic
955117640 3:56021718-56021740 ACTTGAGTGGGGAAGGTGGGAGG - Intronic
959190291 3:103102989-103103011 GCAACAATGGGCCATGTGGGTGG + Intergenic
960025079 3:112999768-112999790 GATTCATGGGGAAAGGTGGGAGG - Intronic
961394619 3:126578392-126578414 GTTTCCCTGGGCAGGGTGGGAGG + Intronic
961627283 3:128272792-128272814 GCTGGAAGGGACAAGGTGGGAGG + Intronic
961643404 3:128379291-128379313 GCTTCAATGGCCAAAGCGGGAGG - Intronic
961661778 3:128472816-128472838 GTTTCAAGGGGCTAGGTGTGTGG + Intergenic
961815620 3:129548685-129548707 GCGTCAAGGGGCGAGGTGGTGGG + Intronic
962596128 3:136945796-136945818 GCTACAATGGACAAGTTGGATGG + Exonic
963644301 3:147894777-147894799 GCTTGGAAGGCCAAGGTGGGAGG + Intergenic
964004855 3:151814745-151814767 GATTCAATGGGCAGGCTGGTTGG + Intronic
965702012 3:171467696-171467718 ACTTCAGTGGCCAAGGTGGGAGG - Intergenic
966202499 3:177371990-177372012 ACTTCAATAGGCAAAGGGGGTGG - Intergenic
967853428 3:194098884-194098906 CCTTCTGTGTGCAAGGTGGGTGG - Intergenic
967902851 3:194474395-194474417 GCTTGGAAGGCCAAGGTGGGAGG - Intronic
968475510 4:804850-804872 GCCTCCACGGGAAAGGTGGGCGG + Intronic
969075691 4:4575815-4575837 GCATCACTTTGCAAGGTGGGTGG + Intergenic
969232816 4:5843339-5843361 GCTACAAAGGGGAAGGTGGATGG - Intronic
969358102 4:6643088-6643110 GCTTCAATCTGGAAGGAGGGTGG - Intergenic
972329104 4:38047322-38047344 GGTTCAGTAGGCAGGGTGGGGGG + Intronic
973616649 4:52685561-52685583 GCATCACATGGCAAGGTGGGCGG + Intergenic
973897766 4:55432612-55432634 GTTTCATGGGGCAGGGTGGGGGG + Exonic
974232497 4:59135213-59135235 TATTCAATGGCCAGGGTGGGGGG + Intergenic
977058778 4:92229310-92229332 GCTTGAGGGGGGAAGGTGGGAGG + Intergenic
979615742 4:122740408-122740430 GGTTCAATGGGAAAGGTATGTGG - Intronic
982091173 4:151881087-151881109 GGTTGAATGGGCCAGGTGAGAGG - Intergenic
982251697 4:153413720-153413742 GCTGCACTGGGGAGGGTGGGAGG - Intronic
982683086 4:158456216-158456238 ACTTGAAGGGGGAAGGTGGGAGG + Intronic
984201058 4:176721729-176721751 GCTTATTTGGGCAAGGTGGTAGG + Intronic
985386912 4:189457191-189457213 GCTTCAATGGGCATGGAGAAAGG - Intergenic
985867375 5:2524528-2524550 GCAGCGATGGGCCAGGTGGGCGG - Intergenic
986266536 5:6196109-6196131 GCTTCCAAGGGCATGGTCGGGGG - Intergenic
986332422 5:6727280-6727302 GGTCCCAGGGGCAAGGTGGGAGG - Intronic
986473373 5:8097792-8097814 GCTTCTATGTGAAAAGTGGGTGG - Intergenic
988109576 5:26800794-26800816 CCTTCAATGGACATGGAGGGTGG - Intergenic
990076083 5:51847535-51847557 ACTTGAAAGGGTAAGGTGGGAGG + Intergenic
990358885 5:54997956-54997978 GCCTAGATGGGCAATGTGGGTGG - Intronic
992044030 5:72866643-72866665 ACTTGAAGGGTCAAGGTGGGAGG + Intronic
993138194 5:83997103-83997125 GGTTTAATGGGAAAGGTGGCTGG + Intronic
993933601 5:93973055-93973077 GCTTCAGTGGCTAAAGTGGGAGG - Intronic
994616992 5:102116401-102116423 GTTTCAAAGGCCAAGGAGGGTGG - Intergenic
996991512 5:129637961-129637983 ACTTGAATGGGGAGGGTGGGAGG + Intronic
998558018 5:143144649-143144671 CCTTCAGAGGCCAAGGTGGGAGG - Intronic
1000275808 5:159733723-159733745 GCTTCAGGGTGAAAGGTGGGAGG - Intergenic
1001400295 5:171442364-171442386 CCTTCAGTGGGGAAGGAGGGAGG + Intronic
1001592457 5:172874813-172874835 CCTTGAAAGGCCAAGGTGGGAGG + Intronic
1002375405 5:178785304-178785326 GCTTCCTTGGGGAAGGGGGGCGG + Intergenic
1002397684 5:178970904-178970926 GCTTCGATGGTCATTGTGGGGGG - Intergenic
1003521750 6:6863920-6863942 TCTTCAATGGGGAAGGAGTGTGG - Intergenic
1005105767 6:22222824-22222846 CCTGCAAGGGGCATGGTGGGAGG - Intergenic
1005296005 6:24427996-24428018 ACTTGAGTGGGGAAGGTGGGAGG + Intronic
1005442397 6:25884205-25884227 GTTACAATGGGCCAGATGGGAGG - Intergenic
1007668704 6:43533591-43533613 GCTTTAAAGGCCATGGTGGGAGG + Intronic
1008449062 6:51628223-51628245 ACTTGAGTGGGGAAGGTGGGAGG - Intronic
1009749232 6:67861744-67861766 GCTTCACTGGGAAAAGTTGGTGG + Intergenic
1011696384 6:89917467-89917489 GCAGCAATGGGCTAGGTGGGTGG + Intergenic
1013788432 6:113808952-113808974 GATTCAATGGGTCAGGTGTGGGG - Intergenic
1016336290 6:143008500-143008522 GATTGAATGGGAAATGTGGGGGG - Intergenic
1019575624 7:1736292-1736314 GCTCCAGGGGGAAAGGTGGGCGG - Intronic
1020290621 7:6719802-6719824 GCTGCCATGGGCGAGGTGGATGG + Intergenic
1020331491 7:7021852-7021874 ACTTGAAGGGGCAGGGTGGGAGG - Intergenic
1021315605 7:19144558-19144580 GCTTCCGTGGGCTGGGTGGGTGG - Intergenic
1023882462 7:44328069-44328091 GCTTGAAAGGACAAGGTGGGAGG - Intronic
1024975344 7:55109048-55109070 GCTGCAAGGGAGAAGGTGGGAGG + Intronic
1025943143 7:66087920-66087942 CCTTAAATGGGTAAAGTGGGTGG + Intronic
1026649733 7:72205444-72205466 GTTTGAAAGGCCAAGGTGGGTGG - Intronic
1026674677 7:72418765-72418787 CCTTCAGAGGGCAAGGTGGGAGG + Intronic
1026739830 7:72972118-72972140 ACTTCAAGAGCCAAGGTGGGAGG - Intergenic
1026955336 7:74373067-74373089 GCATCAAAGGGCAAGGTGGCTGG - Intronic
1027103903 7:75392952-75392974 ACTTCAAGAGCCAAGGTGGGAGG + Intergenic
1030416680 7:109252759-109252781 ACTTCAGTGGGGAGGGTGGGAGG + Intergenic
1031273213 7:119681556-119681578 GTTTGAAAGGCCAAGGTGGGAGG - Intergenic
1031295455 7:119996813-119996835 GCTTAAAAAGGCAGGGTGGGAGG + Intergenic
1032705984 7:134421754-134421776 CCTTCATTGGGCCAGATGGGGGG - Intergenic
1033677344 7:143556271-143556293 GCAACTTTGGGCAAGGTGGGTGG + Intergenic
1033694490 7:143773165-143773187 GCAACTTTGGGCAAGGTGGGTGG - Intergenic
1034374304 7:150629140-150629162 TCTGCACTGGGCTAGGTGGGTGG - Intronic
1034750749 7:153566760-153566782 TCTTCAATAGGCAAGCTGGTTGG - Intergenic
1035023931 7:155814564-155814586 TCTGCAAGGGGCAGGGTGGGTGG + Intergenic
1035412099 7:158653123-158653145 CCTTGAAAGGCCAAGGTGGGTGG + Intronic
1036248409 8:7140681-7140703 GCAGCACTGGGCCAGGTGGGCGG + Intergenic
1038259751 8:25982438-25982460 GGTTCAAGGGGCAAGGAGTGAGG - Intronic
1040470027 8:47729206-47729228 GCTTCCCTAGGAAAGGTGGGAGG + Intronic
1041954016 8:63537283-63537305 GCTTAAATGGGCAAAGTATGGGG + Intergenic
1042164506 8:65932844-65932866 GCTTTAATTCACAAGGTGGGTGG + Intergenic
1044356723 8:91230989-91231011 GCATCAAAGAGCAAAGTGGGTGG + Intronic
1045592905 8:103618316-103618338 ACTTGAATGGGGAGGGTGGGAGG + Intronic
1047202467 8:122779306-122779328 GGTGGAATGGGCCAGGTGGGAGG - Intergenic
1047327802 8:123856866-123856888 GCATCACTGGGCAAGCTGGGCGG + Intronic
1048167144 8:132072982-132073004 GCTTCAATGGGGAATTTGAGGGG - Intronic
1049578648 8:143400940-143400962 GCATCCATCGGCAAGGGGGGAGG + Intergenic
1049959366 9:723514-723536 ACTCCAAAGGCCAAGGTGGGAGG + Intronic
1051317708 9:15859909-15859931 ACTTCCGTGGCCAAGGTGGGAGG - Intronic
1053028211 9:34749487-34749509 CCTTGAAAGGCCAAGGTGGGAGG + Intergenic
1055670962 9:78605789-78605811 GCTGCAAGGGGCAAGGTGCTGGG + Intergenic
1057760557 9:97870530-97870552 ACTGCAATGGGAAAGGTTGGAGG - Intergenic
1058406755 9:104685062-104685084 GTTTCCAGGGGCTAGGTGGGGGG + Intergenic
1059374636 9:113872698-113872720 GCTTCAAGGGGGAGGGTGTGTGG - Intergenic
1060282652 9:122224827-122224849 GCATCACTGGGCAGGGTTGGGGG - Intronic
1061842623 9:133368198-133368220 GCGTCACTGGGCAGGCTGGGAGG - Intronic
1185843942 X:3419533-3419555 GCTTGAAGGGGGAGGGTGGGAGG - Intergenic
1187423758 X:19159502-19159524 ACTGCATTGGGCAAGTTGGGGGG + Intergenic
1187531674 X:20102761-20102783 GCTGTAATGGGCGGGGTGGGGGG + Intronic
1187654578 X:21456367-21456389 GTTACAATGGACAGGGTGGGAGG - Intronic
1190252037 X:48734249-48734271 GCTTCCATGTTCAAGGTGTGAGG - Intergenic
1193230072 X:79033442-79033464 GCTATAATAGGCAAGGTGGTTGG + Intergenic
1193358188 X:80547949-80547971 AATTCAACGTGCAAGGTGGGTGG + Intergenic
1194258001 X:91657870-91657892 CATTCACTGGCCAAGGTGGGAGG + Intergenic
1195583271 X:106532438-106532460 TCATCACTGGGCAAGGTGGTAGG - Intergenic
1196248412 X:113428663-113428685 TCTGCTATGGCCAAGGTGGGAGG - Intergenic
1199214420 X:145249245-145249267 GATTTAATGGGCAATGTGTGAGG + Intronic
1200576766 Y:4897372-4897394 CATTCACTGGCCAAGGTGGGAGG + Intergenic
1200731558 Y:6748419-6748441 GACTCAAGGGGGAAGGTGGGAGG - Intergenic
1201401493 Y:13608729-13608751 GCTTCAATGCTCAAGGGGAGGGG + Intergenic
1201504421 Y:14681885-14681907 ACTGCAATGGGCCAGGCGGGTGG - Intronic