ID: 1093064536

View in Genome Browser
Species Human (GRCh38)
Location 12:14643020-14643042
Sequence AACGGATTTGTAAAGTATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093064536_1093064538 23 Left 1093064536 12:14643020-14643042 CCTTTATACTTTACAAATCCGTT 0: 1
1: 0
2: 1
3: 15
4: 166
Right 1093064538 12:14643066-14643088 TCTCACCACAATCCTGAAAGAGG 0: 1
1: 0
2: 0
3: 26
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093064536 Original CRISPR AACGGATTTGTAAAGTATAA AGG (reversed) Intronic
906090470 1:43174926-43174948 ATCTGATTTGTAAAGAGTAATGG - Intronic
906622120 1:47290968-47290990 AAAGGATGTGTTAAGTGTAAGGG - Intronic
909395299 1:75165200-75165222 AACGCATTTAAAAAGTATGAAGG - Intergenic
910231814 1:84995984-84996006 AACGGTTTTCTAAAGGAGAAGGG + Intronic
911876456 1:103169911-103169933 CACTGATTTGTAAAGTATTTTGG - Intergenic
912830957 1:112953524-112953546 AAGGGATTTTTAAGGGATAAAGG - Intronic
913012704 1:114700203-114700225 AACGCATTCCTTAAGTATAAAGG - Intergenic
914938952 1:152005234-152005256 AATGGATTTGTAAAATATAATGG - Intergenic
915264943 1:154709995-154710017 AAATGCTTTGTAAACTATAAAGG - Intronic
917039645 1:170790272-170790294 AACAGGTTTTTAAAGCATAAAGG + Intergenic
917830422 1:178877976-178877998 AATGACTTTGTAAACTATAAAGG - Intronic
917941901 1:179930641-179930663 AAAGCTTTTGTAAAGTATACAGG + Intergenic
918036744 1:180880975-180880997 AACGGTTTTCTAAAGGATAAGGG + Intronic
918691241 1:187482224-187482246 AACAAATTTGTAAAGAGTAAAGG + Intergenic
918754964 1:188328632-188328654 CAGAGATTTGTAAAATATAATGG - Intergenic
918770687 1:188554886-188554908 AAAGGATTTGGAAATTAGAAAGG + Intergenic
919021268 1:192108804-192108826 AAGGGCTTTGAAAAGCATAAAGG - Intergenic
919955748 1:202413541-202413563 AAATGATTTCTTAAGTATAAAGG - Intronic
922789302 1:228301885-228301907 AAAGGATTTGTTAAGCAAAAAGG - Intronic
923686744 1:236158837-236158859 AGAGGATTTATAAAGTAAAATGG + Intronic
923932318 1:238715618-238715640 AACCAAGTTGTAAATTATAAAGG - Intergenic
1065294861 10:24264652-24264674 AAGGGATTTGTAAAGAAACAGGG + Intronic
1065855124 10:29823840-29823862 AAAGTCTTTATAAAGTATAACGG - Intergenic
1071943338 10:90612423-90612445 ACAGGATTTGGAAAGGATAAAGG - Intergenic
1073585350 10:104704640-104704662 AAAGGTTTTGTAAAGTGTAATGG + Intronic
1075313851 10:121436501-121436523 ATCAGATTTGGAAAGAATAAGGG + Intergenic
1075882758 10:125868149-125868171 AAAGGATTTTTAAAATAAAATGG - Intronic
1075892558 10:125965927-125965949 AAGTGATTTGAAATGTATAAAGG - Intronic
1077759963 11:5084265-5084287 AATGGATTTCTAAAGAATATAGG + Intergenic
1083336567 11:61925155-61925177 AACAGATTTGGAAAGGTTAAAGG + Intergenic
1083529469 11:63406390-63406412 TAGGGATTGTTAAAGTATAAAGG - Intronic
1085975548 11:81649033-81649055 AAATCATTTGTAAACTATAAAGG + Intergenic
1087220149 11:95538328-95538350 GGGTGATTTGTAAAGTATAAAGG - Intergenic
1087470966 11:98573889-98573911 AACAGAATGGTTAAGTATAAAGG - Intergenic
1088261722 11:107950258-107950280 TAGGGATTTGTAAAGTCAAAAGG - Intronic
1088564116 11:111149661-111149683 AACAGATTTGTAAATAATAACGG + Intergenic
1089046670 11:115506566-115506588 AAGTGATATGTAAACTATAAAGG + Intergenic
1092141754 12:6188799-6188821 AAGTGCTTTGTAAACTATAAGGG - Intergenic
1092446808 12:8565550-8565572 AACGGATTTGTCAAGTGTGGTGG - Intergenic
1093064536 12:14643020-14643042 AACGGATTTGTAAAGTATAAAGG - Intronic
1093603922 12:21066234-21066256 AGCTGTTTTGTAAAGTATACAGG + Intronic
1094127422 12:27037954-27037976 AAAGAATTTTTAAAATATAAAGG + Intronic
1094684251 12:32695187-32695209 GAGGGATTTTTAGAGTATAAAGG + Intronic
1095343529 12:41121075-41121097 AAAAGATTTGTAAAGTTTATTGG - Intergenic
1096093502 12:48918964-48918986 AAGGGATTTGGAAAGGATAGCGG + Intronic
1096151892 12:49319251-49319273 AATGGGTAAGTAAAGTATAATGG + Intergenic
1100090537 12:90963676-90963698 AATGTATTTGAAAATTATAATGG - Exonic
1100787885 12:98097814-98097836 AAGGGGTTTGTAATCTATAATGG - Intergenic
1102831896 12:116010066-116010088 AACGGATTTGTGGGGCATAATGG + Intronic
1103144482 12:118582758-118582780 AATGCATTTGTAAACTATCATGG + Intergenic
1104702340 12:130916500-130916522 TACGGATTTGTAACTTATTACGG + Intergenic
1106726190 13:32488153-32488175 AACGTAGCTGTATAGTATAATGG - Intronic
1107782552 13:43919907-43919929 AAAGGATTTTTAAAGGAGAAAGG - Intergenic
1109604359 13:64673199-64673221 AAAGGATTTTTAAAGGATAATGG - Intergenic
1111062601 13:83042218-83042240 AAGGGATTTTTAAAGAGTAAAGG + Intergenic
1111233661 13:85378997-85379019 ACCTGTTTTGTAAAGTGTAAAGG - Intergenic
1111283903 13:86063711-86063733 AACTGATTTGTAAAGAAAAGAGG + Intergenic
1111938768 13:94586498-94586520 AATGGATGTGTAAAGAACAATGG + Intronic
1112041191 13:95550208-95550230 TATGGATTTTTGAAGTATAATGG + Intronic
1113050932 13:106211108-106211130 AAGGGCTTTGAAAAGTTTAATGG + Intergenic
1113309397 13:109116282-109116304 AAGGGCTTTGTAAGGTATGAGGG - Intronic
1114746980 14:25159502-25159524 AAAAGATTTGAAGAGTATAATGG - Intergenic
1116266182 14:42693353-42693375 CACCCATTTGAAAAGTATAATGG - Intergenic
1118412734 14:65499510-65499532 AATCAATTTGTAAAGAATAATGG + Intronic
1120429305 14:84394311-84394333 AACTAATTTATAAAGTATATGGG - Intergenic
1120718872 14:87869126-87869148 AACTCTTTTGTAAAGTATCAGGG + Intronic
1125568819 15:40698542-40698564 AACACATTTATAATGTATAATGG + Intronic
1126432878 15:48605059-48605081 AAGGGGTTTGAAAAGTGTAAAGG + Intronic
1127130927 15:55862509-55862531 AAATTATTTGTAAAATATAAAGG - Intronic
1131311060 15:91290220-91290242 AGGGGAATTGTAAAGTTTAAAGG + Intronic
1132033164 15:98455671-98455693 AAAGTTTTTGTAAAGTAAAAAGG + Intronic
1134148913 16:11790100-11790122 AAAGAATTTCTAAAGGATAAAGG + Intronic
1138277298 16:55744592-55744614 AATTGATTTTTAAAGTATATAGG - Intergenic
1138285753 16:55808858-55808880 AATTGATTTTTAAAGTATATAGG + Intronic
1139052151 16:63137701-63137723 AACATATTTGTAAAATAAAAAGG + Intergenic
1147299456 17:39513251-39513273 GTCAGAATTGTAAAGTATAAAGG - Intronic
1148435108 17:47677913-47677935 AAAGGTTTTGTAAGCTATAAAGG + Intronic
1149793445 17:59499423-59499445 AACGTCTTTTTAAAGTAGAAGGG + Intergenic
1153683030 18:7518521-7518543 AAAGGGTCTGTAAAGCATAAAGG - Intergenic
1156167256 18:34437131-34437153 AAGGGATTTATAATCTATAAAGG + Intergenic
1156461864 18:37325757-37325779 AACAGATTGGTAAAGGAGAACGG + Intronic
1156498173 18:37539776-37539798 AACGGATTTTTAAATTACATTGG + Intronic
1156639742 18:39077706-39077728 AATTGATTTGAAAAGTGTAAAGG + Intergenic
1159253374 18:65910892-65910914 AACGGGTTATTGAAGTATAAAGG + Intergenic
1160086120 18:75779103-75779125 AAAGGATTTGGAAGGTAAAAGGG - Intergenic
1165216373 19:34276509-34276531 AACAGATTTGTAAAAGTTAAAGG + Intronic
1167958626 19:53088157-53088179 AATAGATTTGTAAAGGTTAACGG + Intronic
926003318 2:9351925-9351947 GACTGATTTGTAAAATAAAATGG + Intronic
929104414 2:38349878-38349900 AATAGATTTCAAAAGTATAATGG + Intronic
929966114 2:46538202-46538224 AATGGATTTGGAAAGGATAAGGG - Intronic
933513215 2:83267270-83267292 AACAGATATGTAAAGGATTAGGG + Intergenic
935454502 2:103251680-103251702 AACAGATTTGTAATGCATATAGG - Intergenic
935467191 2:103412296-103412318 AACCTACTTGTAAAGCATAAAGG - Intergenic
941690549 2:168497181-168497203 AAGGGATATTCAAAGTATAATGG + Intronic
941706839 2:168667835-168667857 AACAGATATTTAAAGTAAAATGG + Intronic
942641160 2:178062000-178062022 AAAGGAGTTTTAAAATATAAAGG - Intronic
943215072 2:185022553-185022575 AAAGCATTCTTAAAGTATAAAGG - Intergenic
944462282 2:199962545-199962567 AAAGGATCTGTATAGTTTAAAGG + Intronic
944648910 2:201809046-201809068 AACAGATTAAGAAAGTATAAAGG - Intronic
945883230 2:215348527-215348549 AACTGATTTGGAAAGTAAAATGG + Intronic
1177250680 21:18586938-18586960 AACAGATATGCAAAGTGTAATGG - Intergenic
1177284274 21:19028391-19028413 AACAGATTTTTATAGTACAAAGG + Intergenic
1178334973 21:31734462-31734484 GATGGATTTGGAAAATATAATGG - Intergenic
1182720045 22:32390434-32390456 AAAGGATTTGGAAAATACAAAGG - Intronic
955528460 3:59846549-59846571 AACGGATTTTTAAAATATATTGG - Intronic
956023768 3:64960300-64960322 AACAGAGATGTAAAGGATAAAGG + Intergenic
957384630 3:79479745-79479767 AACGTATTTATAAATTTTAAGGG - Intronic
957491955 3:80939071-80939093 AACGGATCAATAAAGTACAAAGG + Intergenic
958584284 3:96067048-96067070 ATGGGATTTGTTAAGTATAAAGG + Intergenic
960810813 3:121625780-121625802 AATGGATTTTTAAAGTAAAAAGG + Intronic
963608031 3:147429924-147429946 AATTGATATGTAATGTATAAGGG - Intronic
964426143 3:156555572-156555594 AAAGGATGTGTAAAGGAGAAGGG - Intergenic
964509070 3:157430318-157430340 AAGGGATGTGTAGAGTATGATGG - Intronic
964985815 3:162736708-162736730 AATGAATTTATAAAATATAAAGG - Intergenic
966549696 3:181191172-181191194 AAATGATTTAGAAAGTATAAAGG + Intergenic
966706086 3:182915713-182915735 AATGGCTATGTAAAGAATAATGG - Intronic
967141985 3:186569205-186569227 AACGGCTTTGTAAACTAGCATGG + Intronic
968182366 3:196605622-196605644 CACGCATTTATAAAGTATTATGG + Intergenic
970238198 4:13980315-13980337 AACGCAGGTGTAAAGTATGAGGG - Intergenic
972883532 4:43456115-43456137 AAAGGATTTGTTAAGAGTAAGGG - Intergenic
973970817 4:56212222-56212244 ATTGCATTTGTAAACTATAATGG - Intronic
979896348 4:126162803-126162825 AAAAGATTTGTTAAGAATAAAGG - Intergenic
981889429 4:149717458-149717480 AACGGATTTCTCAGCTATAAAGG - Intergenic
982553789 4:156835631-156835653 ATAGGATTTTTAAAATATAATGG - Intronic
983395708 4:167193268-167193290 AACAGATATGTAAAATATAAAGG - Intronic
984118107 4:175707401-175707423 AATTGATTGGTAAAGTAGAAGGG - Intronic
984887077 4:184458933-184458955 AACAGATCTGTTAAGTAAAATGG - Intronic
989554713 5:42780430-42780452 AAAGGATTGGGAAAGAATAAAGG - Intronic
993001060 5:82380778-82380800 AACGGACTAGTAAAGTAAATTGG - Intronic
994746852 5:103688823-103688845 AAGGGAATTGTAAAATAAAATGG + Intergenic
996160645 5:120158683-120158705 AACAGATTTTTAAAGCAAAATGG + Intergenic
996483197 5:123998959-123998981 AAGTGATTTGCAAAGTATAAAGG + Intergenic
999059922 5:148622928-148622950 AACCTATTTGTAAAGCAAAATGG + Intronic
999856696 5:155602546-155602568 TAGGGATATCTAAAGTATAAAGG - Intergenic
1000101725 5:158023125-158023147 AACTGATTTATAAAGAACAAGGG - Intergenic
1001377146 5:171271724-171271746 AACGGATTTAAAAAGTTTAAAGG + Intronic
1005464102 6:26094948-26094970 TACAGATTTGCAAAGTTTAATGG + Exonic
1005508174 6:26488453-26488475 AAGGGATTTGAAAAGTATTTTGG + Intergenic
1008104086 6:47424279-47424301 AATGAATTTTTAAAGTATATGGG + Intergenic
1009361446 6:62818929-62818951 AAGGGATTTGGAAAGAATAATGG - Intergenic
1012648826 6:101725150-101725172 AACAGATTTGCTGAGTATAAGGG - Intronic
1013234838 6:108188737-108188759 AACTGATTTGTGAAGTTAAAAGG + Exonic
1013336708 6:109170597-109170619 AACACATTTGTAAAGTTAAACGG - Intergenic
1013456053 6:110330507-110330529 AACGGATTTGTAAAGCACCTGGG + Intronic
1014069043 6:117160291-117160313 AAGGGATTTGTAAATTATTTTGG - Intergenic
1017275145 6:152557570-152557592 AAGTGATTTGTTATGTATAAGGG + Intronic
1017412632 6:154185451-154185473 AACTGATTTGTAAAGTTTGGGGG - Intronic
1018115894 6:160585043-160585065 TACGCATTTGGATAGTATAATGG + Exonic
1018655678 6:166033658-166033680 AATCTATTTGTAAAGTGTAACGG - Intergenic
1023331359 7:39120814-39120836 AAGGCTTTTGAAAAGTATAAAGG - Intronic
1023344298 7:39255582-39255604 AACTACTTTGGAAAGTATAAAGG + Intronic
1024680500 7:51681987-51682009 AATGTCTTTGTAAAGAATAATGG + Intergenic
1024686607 7:51752526-51752548 CACGGATTTATAGAGAATAAAGG + Intergenic
1027491597 7:78833990-78834012 AACTGAATTTTAAAGTATAGGGG - Intronic
1027567391 7:79813634-79813656 AAGGGCTTTTTAAACTATAAGGG - Intergenic
1029692782 7:102193234-102193256 AATGTATTTGTAAAGCTTAAAGG - Intronic
1031278802 7:119768313-119768335 AAATGATTTGTAAAATATACTGG + Intergenic
1039371907 8:36993584-36993606 AATGGATTGGTAATGTAGAAGGG - Intergenic
1039514624 8:38121898-38121920 AAGACATTTGTTAAGTATAAGGG - Intronic
1041567096 8:59291046-59291068 AAAGGCTGTGTAAAGTATAAGGG + Intergenic
1042029488 8:64460044-64460066 AACTTATTTGTAAAGGGTAATGG + Intergenic
1043738874 8:83782282-83782304 AAGGGATTGGTAAAGCAGAATGG - Intergenic
1043786501 8:84407554-84407576 AAGAGATATGTAAAGTATATGGG - Intronic
1045713359 8:105012211-105012233 AATTGATTTGGAAAGCATAAAGG - Intronic
1047086706 8:121525460-121525482 AAGTGTTTTGTAAATTATAAAGG - Intergenic
1050797706 9:9565134-9565156 AAAGGTTTTGTAAAGTGGAAAGG + Intronic
1051450951 9:17196407-17196429 AAGGGATTTTTAAAGAATTATGG + Intronic
1051662341 9:19437550-19437572 AAGGTTTTTGTAAAGGATAAGGG - Intronic
1051743241 9:20271263-20271285 AAGGGATCTGTAAATTATATGGG - Intergenic
1053216781 9:36278125-36278147 AACATATTTGAAAAATATAAGGG - Intronic
1053697840 9:40653843-40653865 CACGCATTTGAAAATTATAATGG + Intergenic
1054309131 9:63453251-63453273 CACGCATTTGAAAATTATAATGG + Intergenic
1055967452 9:81879541-81879563 AATGGCTTTGTAAACTATGAAGG - Intergenic
1058175902 9:101737185-101737207 AACGGCTTGGTAAAGTCTGAGGG - Intronic
1186242290 X:7582438-7582460 AAAGGATTTGCAAAGTCTGATGG + Intergenic
1188277915 X:28223917-28223939 ACCTGATTTTTAATGTATAAGGG + Intergenic
1188280660 X:28264178-28264200 AATGGATGTGTAATGTGTAATGG - Intergenic
1188553863 X:31389759-31389781 AAAGGATTCTTAAAGTATATTGG - Intronic
1194375530 X:93128202-93128224 AATGGATTAATAAATTATAATGG + Intergenic
1194851822 X:98880146-98880168 AAATGATTTATAAAATATAAAGG + Intergenic
1194942600 X:100029730-100029752 AAAGGACTTTTAAAGTATAAAGG - Intergenic
1198133534 X:133724023-133724045 AAGTGCTTTGTAAAGAATAAAGG - Intronic
1202578860 Y:26357639-26357661 AAATGATTTCTTAAGTATAAAGG + Intergenic