ID: 1093077269

View in Genome Browser
Species Human (GRCh38)
Location 12:14770939-14770961
Sequence GGGGGCGTCAAGCGCATTTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 2, 2: 2, 3: 6, 4: 36}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093077269_1093077272 -7 Left 1093077269 12:14770939-14770961 CCAGAAATGCGCTTGACGCCCCC 0: 1
1: 2
2: 2
3: 6
4: 36
Right 1093077272 12:14770955-14770977 CGCCCCCACGTCGGGCGAGACGG 0: 1
1: 0
2: 1
3: 3
4: 31
1093077269_1093077277 4 Left 1093077269 12:14770939-14770961 CCAGAAATGCGCTTGACGCCCCC 0: 1
1: 2
2: 2
3: 6
4: 36
Right 1093077277 12:14770966-14770988 CGGGCGAGACGGCGAATCGCCGG 0: 1
1: 0
2: 0
3: 2
4: 17
1093077269_1093077278 20 Left 1093077269 12:14770939-14770961 CCAGAAATGCGCTTGACGCCCCC 0: 1
1: 2
2: 2
3: 6
4: 36
Right 1093077278 12:14770982-14771004 TCGCCGGCTTTGTAATGCCTTGG 0: 1
1: 0
2: 0
3: 3
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093077269 Original CRISPR GGGGGCGTCAAGCGCATTTC TGG (reversed) Exonic
900246893 1:1640518-1640540 GGGGGCATCAAGCGCGTGGCAGG + Intronic
900258115 1:1707650-1707672 GGGGGCATCAAGCGCGTGGCAGG + Intronic
914665971 1:149832808-149832830 GGCGGCGTTAAGCGGATCTCTGG + Intergenic
914669794 1:149860986-149861008 GGCGGCGTTAAGCGGATCTCTGG - Exonic
1073453963 10:103625507-103625529 GGTGGGGGCAAGGGCATTTCAGG + Intronic
1083144316 11:60747304-60747326 GGGGGCATCAAGAGCAATTTTGG + Intergenic
1083274968 11:61591651-61591673 GGGGGCGTGGGGAGCATTTCAGG + Intergenic
1088738873 11:112750752-112750774 GGAGGCGTCAATCTCATCTCTGG - Intergenic
1091583682 12:1803962-1803984 GGGAGGGTCAAGGGCATTCCAGG + Intronic
1093077269 12:14770939-14770961 GGGGGCGTCAAGCGCATTTCTGG - Exonic
1122244402 14:100391793-100391815 GGGGGCCTCAAGACCCTTTCAGG + Intronic
1131548564 15:93336511-93336533 GGGGGCGTCCTGCGCACTGCAGG - Intergenic
1146775748 17:35614133-35614155 GGGGCTGTCAAGAGCATCTCTGG - Intronic
1148698702 17:49575908-49575930 GGGGGCGCCGAGCGCAGATCTGG + Exonic
1150210262 17:63437887-63437909 GGGGGGGACATGCGCATCTCAGG - Intronic
1156516695 18:37686173-37686195 GGGGGTGCCAAGGGCACTTCTGG + Intergenic
1160861834 19:1240420-1240442 GGGGTCGGCGAGCGCATCTCCGG + Intergenic
1163021429 19:14482828-14482850 GGGGGGGGCAAGCCCATTTGGGG + Exonic
936234910 2:110733859-110733881 GGGGGACCCAAGAGCATTTCAGG + Intronic
936351558 2:111716608-111716630 GGGGGAGTCAAGAGCATAGCTGG - Intergenic
1169763658 20:9125066-9125088 GATGGAGTCAAGCGTATTTCAGG - Intronic
1173505632 20:43584950-43584972 TGGGGCCTCAAGTGCATTCCTGG + Exonic
1174177893 20:48656582-48656604 GGGGGAGTCAAGGGGATTTCTGG - Intronic
1183702358 22:39457620-39457642 GGGGGCGCCAAGCGCAGCGCGGG - Intronic
1185039424 22:48496944-48496966 GGGGGCGCCAAGCCTCTTTCTGG - Intronic
1185247212 22:49779560-49779582 GGGGGTGTCATACTCATTTCTGG + Intronic
965700420 3:171455099-171455121 GGGGGCGCAAAGCTCAATTCAGG + Intronic
989707758 5:44358027-44358049 GAGGGGGGCAAGGGCATTTCTGG + Intronic
1005456722 6:26027107-26027129 GGTGGGGTTAAGCGAATTTCCGG - Exonic
1005464977 6:26104071-26104093 GGTGGCGTCAAGCGCATTTCCGG + Exonic
1005473922 6:26188931-26188953 GGCGGCGTCAAGCGTATTTCTGG - Exonic
1005475619 6:26204768-26204790 GGGGGTGTCAAGCGCATTTCTGG + Exonic
1005479324 6:26240549-26240571 GGCGGCGTGAAACGCATTTCGGG + Exonic
1005480012 6:26246832-26246854 GGCGGTGTCAAGCGCATCTTGGG - Exonic
1005484324 6:26285354-26285376 GGCGGTGTCAAGCGAATTTCTGG - Exonic
1005570361 6:27139432-27139454 GGCGGCGTGAAGCGCATTTCTGG + Exonic
1005643994 6:27824248-27824270 GGCGGCGTGAAGCGCATCTCCGG + Exonic
1005645203 6:27831382-27831404 GGCGGCGTGAAGCGCATCTCCGG - Exonic
1005649457 6:27873365-27873387 GGAGGCGTTAAGCGCATCTCAGG - Exonic
1007837030 6:44681882-44681904 GGGGGCGTCCAGCGCAGCTGAGG - Intergenic
1019578127 7:1747267-1747289 CGGGGCGACAAGCGCATCCCAGG - Exonic
1021551202 7:21872856-21872878 GAGGGTGTCAGGCACATTTCTGG + Intronic
1032314572 7:130823360-130823382 GATGGTGTCAAGAGCATTTCTGG - Intergenic
1057800491 9:98188176-98188198 GGGTGAGTCAGGCTCATTTCTGG - Intronic
1057806146 9:98221156-98221178 GCGGGCGTCCAGCGCATACCTGG - Exonic
1189416285 X:40817078-40817100 GGGGACCTCACACGCATTTCAGG - Intergenic
1195307417 X:103598100-103598122 GGGGACATCAATGGCATTTCTGG - Intergenic