ID: 1093079616

View in Genome Browser
Species Human (GRCh38)
Location 12:14794611-14794633
Sequence CCTCAAGTCGTGCAGATGTA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 2, 1: 1, 2: 1, 3: 4, 4: 43}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093079616_1093079627 4 Left 1093079616 12:14794611-14794633 CCATACATCTGCACGACTTGAGG 0: 2
1: 1
2: 1
3: 4
4: 43
Right 1093079627 12:14794638-14794660 GGTGGACCAGGGGGAGGGCCAGG 0: 1
1: 2
2: 2
3: 87
4: 748
1093079616_1093079630 19 Left 1093079616 12:14794611-14794633 CCATACATCTGCACGACTTGAGG 0: 2
1: 1
2: 1
3: 4
4: 43
Right 1093079630 12:14794653-14794675 GGGCCAGGAGGTTTTCTGCCAGG 0: 1
1: 2
2: 3
3: 23
4: 199
1093079616_1093079625 -2 Left 1093079616 12:14794611-14794633 CCATACATCTGCACGACTTGAGG 0: 2
1: 1
2: 1
3: 4
4: 43
Right 1093079625 12:14794632-14794654 GGAGGAGGTGGACCAGGGGGAGG 0: 1
1: 2
2: 14
3: 480
4: 5264
1093079616_1093079621 -8 Left 1093079616 12:14794611-14794633 CCATACATCTGCACGACTTGAGG 0: 2
1: 1
2: 1
3: 4
4: 43
Right 1093079621 12:14794626-14794648 ACTTGAGGAGGAGGTGGACCAGG 0: 1
1: 2
2: 3
3: 23
4: 322
1093079616_1093079626 -1 Left 1093079616 12:14794611-14794633 CCATACATCTGCACGACTTGAGG 0: 2
1: 1
2: 1
3: 4
4: 43
Right 1093079626 12:14794633-14794655 GAGGAGGTGGACCAGGGGGAGGG 0: 1
1: 2
2: 11
3: 165
4: 1722
1093079616_1093079634 22 Left 1093079616 12:14794611-14794633 CCATACATCTGCACGACTTGAGG 0: 2
1: 1
2: 1
3: 4
4: 43
Right 1093079634 12:14794656-14794678 CCAGGAGGTTTTCTGCCAGGGGG 0: 1
1: 2
2: 0
3: 19
4: 217
1093079616_1093079624 -5 Left 1093079616 12:14794611-14794633 CCATACATCTGCACGACTTGAGG 0: 2
1: 1
2: 1
3: 4
4: 43
Right 1093079624 12:14794629-14794651 TGAGGAGGAGGTGGACCAGGGGG 0: 1
1: 3
2: 9
3: 418
4: 5025
1093079616_1093079631 20 Left 1093079616 12:14794611-14794633 CCATACATCTGCACGACTTGAGG 0: 2
1: 1
2: 1
3: 4
4: 43
Right 1093079631 12:14794654-14794676 GGCCAGGAGGTTTTCTGCCAGGG 0: 1
1: 0
2: 4
3: 16
4: 208
1093079616_1093079622 -7 Left 1093079616 12:14794611-14794633 CCATACATCTGCACGACTTGAGG 0: 2
1: 1
2: 1
3: 4
4: 43
Right 1093079622 12:14794627-14794649 CTTGAGGAGGAGGTGGACCAGGG 0: 1
1: 1
2: 4
3: 21
4: 341
1093079616_1093079628 7 Left 1093079616 12:14794611-14794633 CCATACATCTGCACGACTTGAGG 0: 2
1: 1
2: 1
3: 4
4: 43
Right 1093079628 12:14794641-14794663 GGACCAGGGGGAGGGCCAGGAGG 0: 1
1: 2
2: 6
3: 112
4: 998
1093079616_1093079632 21 Left 1093079616 12:14794611-14794633 CCATACATCTGCACGACTTGAGG 0: 2
1: 1
2: 1
3: 4
4: 43
Right 1093079632 12:14794655-14794677 GCCAGGAGGTTTTCTGCCAGGGG 0: 1
1: 1
2: 2
3: 13
4: 155
1093079616_1093079623 -6 Left 1093079616 12:14794611-14794633 CCATACATCTGCACGACTTGAGG 0: 2
1: 1
2: 1
3: 4
4: 43
Right 1093079623 12:14794628-14794650 TTGAGGAGGAGGTGGACCAGGGG 0: 1
1: 1
2: 1
3: 35
4: 411

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093079616 Original CRISPR CCTCAAGTCGTGCAGATGTA TGG (reversed) Exonic
902253110 1:15169008-15169030 CCTTAAGTCCTTCAGATGTGGGG - Intronic
903382954 1:22909394-22909416 CCTGAAGACGTGCTGATGTGTGG - Intronic
910864153 1:91772435-91772457 CCTCAAGTCTAGGAGATTTAGGG - Intronic
921521662 1:216163435-216163457 CCTCAAGTAATTCAGATATATGG - Intronic
1070074811 10:73124538-73124560 CCTAAAGACATGCAGATCTATGG + Intronic
1081885846 11:46495548-46495570 CCTGAAATTGTGCAGATGAAAGG + Intronic
1089372473 11:117971108-117971130 CCCCAACTCATGCAGATTTAAGG + Intergenic
1093079616 12:14794611-14794633 CCTCAAGTCGTGCAGATGTATGG - Exonic
1094775186 12:33718590-33718612 ACTCAAGTCCTGCAGAGGAAGGG + Intergenic
1095632444 12:44394306-44394328 CAACAAGTCATGCAGATGTGAGG + Intergenic
1099256963 12:80326098-80326120 CCTCAAGTACTGCAGGTATAAGG - Intronic
1102709627 12:114914743-114914765 CCTCAAGCCCTGCAGATACAAGG - Intergenic
1109191537 13:59329704-59329726 CCTCAAGTGGTGCAGGGGCAAGG + Intergenic
1112121342 13:96415324-96415346 CCCCAAGTCGTGCTGATGAAAGG + Intronic
1115440770 14:33433069-33433091 CATCAAGTTGTGAGGATGTATGG + Intronic
1125973840 15:43934042-43934064 CCTCAAGGAGCGTAGATGTAGGG - Intronic
1131665904 15:94571050-94571072 CCTCAAGTCAGGCAGACGTTTGG - Intergenic
1131977878 15:97963607-97963629 CCTCAGGTCCTGAAGATGTCGGG + Intronic
1136088357 16:27901651-27901673 CCCCAGGTCGTTCAGATGCACGG + Intronic
1136452325 16:30360321-30360343 CCTCAAGAAGAGCAGATCTAGGG - Intronic
1141746201 16:85928062-85928084 TCTCAACTCGTGCAGATGGAGGG + Intergenic
1143195401 17:5072478-5072500 CCTCCAGCTGTGAAGATGTAAGG - Intergenic
1156012641 18:32512471-32512493 CCTCAAGTCGTGCAGATGTATGG + Intergenic
1156909051 18:42389057-42389079 CCTCAATTCTTGCTGATGTTTGG + Intergenic
1161744111 19:6044537-6044559 CCACAATTCGTGCATATGTGTGG - Intronic
1162326834 19:10004391-10004413 CCTCTAGTGGGGCAGATGTGTGG - Intronic
935727305 2:106034924-106034946 CGACAAGTCATGCTGATGTATGG + Intergenic
937936289 2:127248201-127248223 CCTCAAGTCTTGCACATGTATGG + Intergenic
942076009 2:172357863-172357885 ACTCAAGACGTGCAGATACAGGG + Intergenic
1171879472 20:30607121-30607143 CCTCAAGACATGCACATATAAGG + Intergenic
1182236937 22:28883579-28883601 CCTCACGTGGAGCAGATGAAAGG + Exonic
956616467 3:71177559-71177581 TCTGGAGTCGGGCAGATGTAGGG + Intronic
959480372 3:106865173-106865195 CCTCAAGGCCTGCAGCTGCAGGG + Intergenic
968826333 4:2900417-2900439 CCTCAAGTGGTGTAGATGTGAGG + Intronic
972877399 4:43380300-43380322 CCTTTAGTCATGCAGATGCATGG - Intergenic
986141558 5:5035651-5035673 CCTCCAGTGGTGCAGGTGGAGGG - Intergenic
993755138 5:91719891-91719913 CCTCAACTCCAGCAGATGTCTGG + Intergenic
994551706 5:101241897-101241919 CTTAAAGCAGTGCAGATGTAGGG + Intergenic
997758536 5:136422860-136422882 CTTCCAGTCATGCAGATGTTGGG + Intergenic
998767017 5:145499623-145499645 CCTCAGGCCCTGCAGATGTCAGG - Intronic
999701353 5:154231448-154231470 CCTCAAGTTTTCCTGATGTATGG + Intronic
1007844659 6:44743185-44743207 CCTCAAATGGCTCAGATGTAGGG + Intergenic
1020034082 7:4953348-4953370 CCTGAACTCCTGCAGATGTAGGG + Intronic
1036016940 8:4795756-4795778 CCTGAAGGCGTGCACAGGTACGG - Intronic
1036221203 8:6922926-6922948 GCTCAATTCGTGCAGATCTCAGG - Intergenic
1043228675 8:77769596-77769618 CCTGAAATGTTGCAGATGTAAGG - Intergenic
1055196210 9:73597332-73597354 CCTCAGGTCAAGCAGATGGAGGG + Intergenic
1055730013 9:79270795-79270817 CCTACAGAGGTGCAGATGTAGGG + Intergenic
1061943192 9:133893953-133893975 CCTCAGTTTCTGCAGATGTAAGG - Intronic
1193359186 X:80560767-80560789 TCTCAAGTCGTGCAGATGTACGG + Intergenic
1198079493 X:133225752-133225774 TCTCAAGGCATGCATATGTAGGG + Intergenic