ID: 1093082598

View in Genome Browser
Species Human (GRCh38)
Location 12:14830377-14830399
Sequence TAAGGTAGAAAAGATGTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 322}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093082596_1093082598 -5 Left 1093082596 12:14830359-14830381 CCAGTTTTCACTATTGTTTAAGG 0: 1
1: 0
2: 1
3: 22
4: 232
Right 1093082598 12:14830377-14830399 TAAGGTAGAAAAGATGTTTCTGG 0: 1
1: 0
2: 2
3: 30
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093082598 Original CRISPR TAAGGTAGAAAAGATGTTTC TGG Intronic
902077117 1:13796137-13796159 TGTTGTAGAAAAGATGATTCTGG + Intronic
902101968 1:13997778-13997800 CAAGCTAGAAAACATATTTCAGG + Intergenic
904041682 1:27589028-27589050 GAAGGTAGGTAAGAGGTTTCAGG + Intronic
904730643 1:32588438-32588460 ATAGGTAGAGAAGATGTTTGAGG + Intronic
905944495 1:41890340-41890362 TAGGGTAGAAAAGATGCTCGGGG + Intronic
906300361 1:44677205-44677227 TAAGGTAGCAAACAGATTTCTGG + Intronic
906431524 1:45759472-45759494 GAAGGGAAAACAGATGTTTCAGG - Intergenic
906621484 1:47284587-47284609 TAAGACAGTAAAGATGTTCCTGG + Intronic
908153307 1:61326811-61326833 GTAGGAAGAACAGATGTTTCAGG + Intronic
908334607 1:63108668-63108690 TAATGTGTAAATGATGTTTCTGG - Intergenic
909647767 1:77936662-77936684 TAAGCTAGAAGGGATGTTGCAGG - Intronic
910767503 1:90797056-90797078 TAAGGTAGGAAATATGTTTGAGG + Intergenic
911383155 1:97140862-97140884 TAAGAGAATAAAGATGTTTCTGG + Intronic
911862582 1:102971708-102971730 TAAGGGAGCAAAGATGGTTCTGG - Intronic
911931987 1:103915948-103915970 TAAGGTAGAGAAAATGCTGCTGG + Intergenic
912423749 1:109567320-109567342 AAAGGAAGAGGAGATGTTTCAGG + Intronic
913409043 1:118530681-118530703 TATTTTAGAAAGGATGTTTCAGG - Intergenic
913685544 1:121228375-121228397 CAAGGCAGATAAGATGTTTATGG + Intronic
914037390 1:144015979-144016001 CAAGGCAGATAAGATGTTTATGG + Intergenic
914152063 1:145051953-145051975 CAAGGCAGATAAGATGTTTATGG - Intronic
916547424 1:165818901-165818923 TAAGATAGAAAAGAGGTTAAAGG - Intronic
916582899 1:166124188-166124210 GAAGGTGCAAAAGATGTTCCAGG - Intronic
918729952 1:187980779-187980801 CAAGAAAGAAAAGAGGTTTCAGG - Intergenic
919224584 1:194679451-194679473 CTAGGAAGAAAAGATGTTTCAGG - Intergenic
919845688 1:201640681-201640703 GAAGGGAGAAAAGATGCTGCTGG + Intronic
920472863 1:206246933-206246955 CAAGGCAGATAAGATGTTTATGG + Intronic
920578289 1:207079553-207079575 CAAGGCAGAGAAGATGTTTTAGG - Intronic
923640379 1:235753105-235753127 TAAGGTAGCAGATATGTTGCTGG - Exonic
1062981123 10:1723924-1723946 TGAGGTAGAGATAATGTTTCTGG + Intronic
1063228259 10:4036654-4036676 TGTGGGAGAAAGGATGTTTCAGG + Intergenic
1063685628 10:8235118-8235140 TGATGTAAAAATGATGTTTCTGG - Intergenic
1063778325 10:9290742-9290764 TCAAGTAAAAAATATGTTTCCGG - Intergenic
1064022260 10:11818720-11818742 TAAATTAGAAAATATATTTCAGG - Intergenic
1065204262 10:23343021-23343043 TAATGTAGAGCTGATGTTTCTGG - Intronic
1065412276 10:25442897-25442919 GAATTTAGAAAACATGTTTCTGG - Intronic
1066072764 10:31837165-31837187 TAATGTATAAAAGATCTTTGTGG + Intronic
1067829580 10:49602755-49602777 GTAGGCAGAAAAGATGTTTAAGG - Intergenic
1067961341 10:50854106-50854128 TAAGGTAGAAAAGATTTCTAAGG - Intronic
1068198758 10:53754477-53754499 TTATTTAGAAAAGATGTTTGGGG - Intergenic
1068838725 10:61586476-61586498 TAAGGTGGATGAGATGTTTTAGG - Intergenic
1069392985 10:67956400-67956422 TAAGGTATTAAACATGTTCCTGG - Intronic
1069636470 10:69928193-69928215 TAAAGGAAAAAAAATGTTTCTGG - Intronic
1070427759 10:76305896-76305918 TAAAGGAGAAAAGATTTTTGGGG + Intronic
1071034721 10:81231562-81231584 CCAGTTAGAAAAGATGTTTCTGG - Intergenic
1072417231 10:95259381-95259403 TGAGATAGGAAAGATTTTTCTGG - Intronic
1072811251 10:98463816-98463838 AAAGGTAGAAAACATTTTTCAGG + Intronic
1072812131 10:98470264-98470286 AAAGGGAAAAAAGATGTCTCAGG + Intronic
1073210470 10:101797384-101797406 TAATGTAGCAGAGATGTTTAGGG + Intronic
1073868508 10:107833388-107833410 TAAGCTAGAAAAAATGTCTAAGG + Intergenic
1074076839 10:110135817-110135839 CAATGTAGAATAGATGTTGCAGG + Intergenic
1074169244 10:110917235-110917257 GAAGGTATAAAAGATATTCCTGG + Intronic
1074584913 10:114758510-114758532 AAATGTAGAAAAGAGGTTTGGGG - Intergenic
1075410420 10:122223855-122223877 TTAAGTAGAAAAGAGGTATCTGG + Intronic
1075608240 10:123831805-123831827 TAGGGTAGAAAAGATTTTTCTGG - Intronic
1078194519 11:9124558-9124580 TTAGGTGGAAAACATGTATCTGG - Intronic
1078494725 11:11804956-11804978 AAATGTAGAAAAAATGCTTCTGG + Intergenic
1079228576 11:18629631-18629653 TAAAGGAGAAAAGATATTTTTGG - Intronic
1080629766 11:34063322-34063344 TAAGGCACAAATGATTTTTCTGG + Intronic
1082772444 11:57218774-57218796 TAAAATAAAAAAGAAGTTTCAGG + Intergenic
1083471856 11:62889401-62889423 TAAAGCAGGAAAGGTGTTTCAGG + Intergenic
1085882116 11:80479776-80479798 TGAGGTAGAGGAGATGATTCTGG - Intergenic
1086253486 11:84846309-84846331 TGGGGTAGAAAAGAGGTTTGAGG - Intronic
1086549429 11:88038764-88038786 TAAGCAAGAAATGATGTGTCTGG - Intergenic
1087626876 11:100605325-100605347 TAATTTAGAAAATATATTTCAGG + Intergenic
1088263110 11:107963583-107963605 GAATGCAGAAAAGATTTTTCTGG + Intergenic
1088619733 11:111669876-111669898 AAAGGTAGAAAAGATACTTTAGG - Intronic
1090127612 11:124104612-124104634 TAATGTAGAAAAGAGTTTTGAGG - Intergenic
1090314161 11:125770200-125770222 TGAGGTGGAAAGGATGTTGCTGG - Intergenic
1090314669 11:125775075-125775097 TAAAGTATAAAAGATTTTTTAGG - Intergenic
1090489530 11:127146302-127146324 TAAGGCAGAAAGGCTGTTTTTGG - Intergenic
1091189056 11:133674669-133674691 TTAGGTAGAACAGATGGTTGTGG - Intergenic
1092575733 12:9780989-9781011 TAACTTGGAAAATATGTTTCAGG - Intergenic
1093082598 12:14830377-14830399 TAAGGTAGAAAAGATGTTTCTGG + Intronic
1093440380 12:19188531-19188553 TAGATTAGAAATGATGTTTCTGG + Intronic
1093517183 12:20002302-20002324 TAAGGAAAAAAAGATGTTAAGGG + Intergenic
1093657592 12:21714246-21714268 AAAGAGAGAAAAGATGGTTCTGG - Intronic
1093933477 12:24977333-24977355 TAAGGAAGAAAGGAAGTTGCAGG + Intergenic
1094065600 12:26358054-26358076 CAAGGCAGAAAAGATTTATCTGG + Intronic
1094704093 12:32897472-32897494 TGAGGAAGAACATATGTTTCTGG - Intergenic
1094820164 12:34218642-34218664 TAAGGTAGAACAGATCTCTCTGG - Intergenic
1097093124 12:56523438-56523460 TAAGGTATACAACATGTTACGGG - Intronic
1099234173 12:80062521-80062543 GCAGGTAGAAAGGATGTTGCAGG - Intergenic
1099608914 12:84839970-84839992 TAATCTAGAAAAAGTGTTTCTGG - Intergenic
1100693374 12:97063987-97064009 GAAGGGAAGAAAGATGTTTCAGG + Intergenic
1101159163 12:101955899-101955921 GAAGGCAGAAAATGTGTTTCTGG + Intronic
1101219416 12:102621840-102621862 CAAAGTATAAAAGATTTTTCAGG + Intergenic
1102833728 12:116033019-116033041 TGGGGTAGAAAAAAGGTTTCTGG + Intronic
1103069564 12:117929824-117929846 GAAAGTAGAATAGATGTTACCGG + Intronic
1104083036 12:125448457-125448479 TAAAGATGAAAAGATGTGTCTGG + Intronic
1104160280 12:126172593-126172615 TAAAGGAGAAGAGATGTTGCTGG + Intergenic
1106083544 13:26520586-26520608 TTAAGTAGAAAAGTTGCTTCAGG + Intergenic
1106905522 13:34405252-34405274 TAAGATTGAAAAGGTGTTTATGG - Intergenic
1108793934 13:54007716-54007738 TAAACTATAAAAGATATTTCTGG - Intergenic
1108879606 13:55093971-55093993 TCAGGTTGAAAAGAGGTTACAGG + Intergenic
1111068304 13:83127792-83127814 TATGGTAGAAAAAATATTTAAGG - Intergenic
1111555046 13:89869357-89869379 GAAGGTAGAATAGAAGTGTCTGG - Intergenic
1111965480 13:94857545-94857567 AAAGGTAGAAATGAATTTTCTGG + Intergenic
1112633643 13:101189804-101189826 AAAGTTAGAACAGATGTTTTGGG + Intronic
1112819465 13:103314514-103314536 TGGAGTAGAAAAGATGGTTCAGG + Intergenic
1113515345 13:110891615-110891637 TAAGGTAGAAAAGATGATGTTGG + Intronic
1114914485 14:27245962-27245984 TAAGGTTGATAAGATGTTGCAGG + Intergenic
1115199422 14:30836835-30836857 TCTGATACAAAAGATGTTTCAGG - Intergenic
1115943196 14:38631212-38631234 CAAGTTGGAAAACATGTTTCAGG + Intergenic
1116553485 14:46272729-46272751 TAATGTAAAAAAGAAGTTTAAGG + Intergenic
1117312651 14:54543425-54543447 TTAGGTAGAAAAGAGATTTCAGG + Intergenic
1117423729 14:55574148-55574170 AAAGTTATAAAAGATGTTTTTGG - Intronic
1117946189 14:61024464-61024486 AAAGTCAGAAAAGATGTGTCTGG + Intronic
1120291909 14:82585448-82585470 TAAGGAATAAAAGAAGCTTCTGG - Intergenic
1120342318 14:83237258-83237280 TAATGTTAATAAGATGTTTCTGG + Intergenic
1121864474 14:97349804-97349826 TAATCTAGAAAATATTTTTCTGG - Intergenic
1122193456 14:100066840-100066862 TACAGTAGATAAGATGTTTTGGG + Intronic
1127211055 15:56775202-56775224 TAAGGTAGAAAAAGTGTCTTAGG - Intronic
1128567510 15:68711081-68711103 GAAGGCAGAAAAGATGCCTCCGG - Intronic
1130619901 15:85451948-85451970 CAACTTAGAAAATATGTTTCAGG - Intronic
1130899103 15:88193496-88193518 AAAGGTGGAAAAGATGTGCCTGG - Intronic
1131602789 15:93866525-93866547 AAAGGTAGAAAAGAGGTTAAAGG + Intergenic
1131757274 15:95578797-95578819 AAAGGGAAAAAAGATGTTTGTGG + Intergenic
1131924740 15:97369944-97369966 GAAGGCAGAGAAGATGTTTGAGG + Intergenic
1131953038 15:97702338-97702360 TAAGGTAGAATATAAGTCTCTGG - Intergenic
1133900476 16:9969291-9969313 CAAGGAGAAAAAGATGTTTCAGG - Intronic
1134099193 16:11439691-11439713 TAAGGGAGGACAGAAGTTTCTGG - Intronic
1135647795 16:24178435-24178457 TATTATAGAAAAGAAGTTTCAGG - Intronic
1137469884 16:48744784-48744806 TAAGGAAGAAAAGCTGCTTCAGG - Intergenic
1139795504 16:69480252-69480274 GAAGGTAGATAAGTTGTTTCCGG + Intergenic
1140699664 16:77569814-77569836 TCAGGTACAAAAAATGTTACAGG + Intergenic
1142319214 16:89370295-89370317 TGAGGATGAGAAGATGTTTCTGG + Intronic
1144147873 17:12415646-12415668 TAAGGTAGAAGACATGTGGCGGG + Intergenic
1144169537 17:12646618-12646640 AAAGGTATGAATGATGTTTCTGG - Intergenic
1149003189 17:51778031-51778053 TTAGATAGAAAAGATCCTTCAGG + Intronic
1150144523 17:62756492-62756514 TAAAGAAAAAAAGATGTTTTGGG + Intronic
1150157965 17:62870034-62870056 TAAGCAAGAAAAGATGCTTCGGG - Intergenic
1152531995 17:80924161-80924183 TAAGTTGAAAAAGATATTTCTGG + Intronic
1155353273 18:24927327-24927349 TAAGGTAAATAAGTTGTTACTGG - Intergenic
1156971201 18:43158667-43158689 TATGGTAGAAATGATGTTATGGG - Intergenic
1157420809 18:47546293-47546315 TAAAGGAGAAAAGAATTTTCTGG + Intergenic
1157992826 18:52518085-52518107 TAAGGTATCAAAGATTTTTTAGG - Intronic
1158088819 18:53685651-53685673 AAAGGTAGAGAAGATATATCTGG - Intergenic
1158747679 18:60219896-60219918 TAAGGTGGTAAAGATACTTCCGG - Intergenic
1159180462 18:64895287-64895309 ATAGATAGAAATGATGTTTCAGG - Intergenic
1159578696 18:70210305-70210327 TTACGTAGCAAAGTTGTTTCTGG - Intergenic
1160215566 18:76926508-76926530 TATGGTAGAAAGTAGGTTTCTGG + Intronic
1163936847 19:20454084-20454106 TAAGGTGGAAAAACTGCTTCAGG - Intergenic
1164524306 19:29002156-29002178 AAAAGGAGAAAAGATTTTTCGGG + Intergenic
1164866137 19:31605907-31605929 TAAGGTTGGAAAGGTGTTTGAGG + Intergenic
1166922384 19:46238377-46238399 TAAGATGGAAATGAGGTTTCAGG - Intergenic
926576740 2:14590628-14590650 TTAGGTCGAGAAGATGTTTTGGG - Intergenic
926678535 2:15647049-15647071 GAAAGTAGAATAGAAGTTTCAGG + Intergenic
927364927 2:22283663-22283685 TAAGGAAGAAAAGTTGTGTATGG - Intergenic
928584338 2:32743326-32743348 AAAGGTAGACAAAATATTTCAGG - Intronic
929202709 2:39254087-39254109 CAAGGTAGAAAAGGTGCTTAAGG + Intronic
929639268 2:43559794-43559816 TGAGGTAGAGAGGATGTTTCTGG - Intronic
932067630 2:68583266-68583288 TAGGGTAGTAAAGCTGTTGCAGG - Intronic
932143724 2:69300921-69300943 GAAGGTAGAACAGAGGTTACCGG - Intergenic
932385200 2:71325970-71325992 TAAGATAAAAAATATTTTTCTGG + Intronic
935833195 2:107022016-107022038 CAAAGTAGGAAAGATCTTTCTGG + Intergenic
938254045 2:129840218-129840240 CAAGTTTCAAAAGATGTTTCTGG - Intergenic
939059972 2:137409870-137409892 TAAGGAATAAAAGATATTCCAGG + Intronic
940296020 2:152125235-152125257 GAGGGTAGGAAAGATTTTTCTGG - Intronic
942006770 2:171710011-171710033 TAAGGTTAAAAAGATGTGGCTGG - Intronic
942747457 2:179251340-179251362 GAAAGTACAAAAGAGGTTTCGGG - Intronic
944117036 2:196199154-196199176 GATGGTATACAAGATGTTTCAGG - Exonic
945338910 2:208627962-208627984 CAAGGTAGAAAGGATCTTTCTGG - Intronic
945391641 2:209272610-209272632 TCATGTAGAAAAGATGTTCGAGG - Intergenic
946096656 2:217280471-217280493 TAGGGCAGAAAAGGTGGTTCTGG + Intergenic
946273374 2:218612384-218612406 TCAGGAAGAAAAGATTTTGCTGG - Intronic
947036894 2:225869217-225869239 TAAGATAGAAATGTGGTTTCAGG - Intergenic
947590114 2:231380565-231380587 TAAAATAAAAAAGATGCTTCAGG + Intergenic
948192106 2:236067556-236067578 TGAGAAAGTAAAGATGTTTCTGG + Intronic
1169094024 20:2880217-2880239 TGAGGTAGATAAGATGATCCAGG + Intronic
1169106621 20:3001689-3001711 AAAGGAAGAAAAGATTTTCCTGG - Intronic
1169582669 20:7041882-7041904 AAGGGTACAAAAGAAGTTTCTGG - Intergenic
1170100910 20:12698512-12698534 GAAGGTAAAAAACATGTTCCTGG + Intergenic
1171072989 20:22093123-22093145 TAAGATAGAAAGTATGTTTGAGG - Intergenic
1172428932 20:34874692-34874714 TAAGGGAGCACAGATGTTGCTGG - Intronic
1175157877 20:56984919-56984941 TAAAGTAGAAAAGAGATTTGCGG + Intergenic
1175883619 20:62275022-62275044 AAAGGTAGAAAAGATGAATCAGG + Intronic
1176071515 20:63229168-63229190 TAAGGCAGAAAAGGGGTTTCAGG - Intergenic
1177592966 21:23196578-23196600 TATTTTAGAAAAGAAGTTTCTGG - Intergenic
1177718199 21:24867438-24867460 TTATGTACAAAAGATGTATCAGG - Intergenic
1177790245 21:25715108-25715130 TAGGGGAGAAAAGAGGATTCTGG - Intronic
1178377344 21:32077419-32077441 TAATGAAGAAAAGATGTTACTGG - Intergenic
1179006581 21:37520674-37520696 TCAGGTAGATAAGATATTTCTGG + Intergenic
1179027649 21:37693213-37693235 GAAGGTAGAACTGATGTTTTAGG + Intronic
1179892521 21:44343908-44343930 TATGGCAGGAAACATGTTTCGGG + Intergenic
1183561852 22:38581261-38581283 TAAGTGTGATAAGATGTTTCAGG + Intronic
1183580416 22:38721954-38721976 TAAAAAAGAAAAGAAGTTTCTGG - Intronic
1184348439 22:43927196-43927218 CAAGTTAGAAAAGCTGTTTTGGG + Intronic
1184403752 22:44288332-44288354 TCAGGTAGAAAAGCTGCTCCAGG + Intronic
949714982 3:6919506-6919528 TAAGATATAAAATATATTTCTGG - Intronic
950592544 3:13948724-13948746 TAAGGCTGAAAATATGTTTTGGG + Intronic
951541067 3:23782404-23782426 TAAGGTAGCAAAGCTGTTTTGGG + Intergenic
952399268 3:32948639-32948661 TCAGGTAAAAAACAGGTTTCAGG - Intergenic
952558747 3:34564430-34564452 TAGGGTAGAAAGAATATTTCTGG - Intergenic
953184314 3:40624197-40624219 TCAGGTGGCAAAGGTGTTTCAGG + Intergenic
953226647 3:41027634-41027656 TACAGAAGAAAAGAAGTTTCTGG - Intergenic
953457524 3:43054736-43054758 TAAGGTACTAAAGAATTTTCTGG + Intronic
953583659 3:44180123-44180145 ACAGGATGAAAAGATGTTTCGGG - Intergenic
953677684 3:45016078-45016100 TGAGTTTGAAAAGAAGTTTCTGG + Intronic
955912938 3:63876485-63876507 GAAGCTAGTAAAGATGTTTATGG + Intronic
956116095 3:65920457-65920479 TAAGGTATAATACATGTGTCAGG + Intronic
957194538 3:77050711-77050733 TAATAATGAAAAGATGTTTCAGG + Intronic
957785524 3:84877322-84877344 TAAGGTACAAAAGCTGTCGCTGG + Intergenic
959119432 3:102215387-102215409 TGAGGTACAAAAGATTTTTATGG + Intronic
959237132 3:103739160-103739182 TAAGCAAGAAAAATTGTTTCAGG + Intergenic
964128241 3:153259072-153259094 TTTGGTATAAAAGCTGTTTCTGG - Intergenic
965028938 3:163338275-163338297 TAATGAAGATAAAATGTTTCAGG + Intergenic
965719617 3:171647234-171647256 TCAGGTTGGAAAAATGTTTCTGG + Intronic
965753491 3:172000856-172000878 GAAGGTAGAATAGAGGTTACTGG + Intergenic
966270573 3:178099692-178099714 TTATGTAAAAAAGATGTTTTAGG - Intergenic
967031577 3:185612203-185612225 TTTAGTAGAAAAGCTGTTTCAGG + Intronic
967146138 3:186607950-186607972 CAGGATAGAAAAAATGTTTCTGG - Intergenic
967829256 3:193904782-193904804 TAAGGTGGAAGAAATGTCTCCGG - Intergenic
968980554 4:3846912-3846934 TAAGGAAGAAAATATCCTTCAGG + Intergenic
969303581 4:6311786-6311808 AAAGGAAGCAAAGATGTTGCCGG - Intergenic
973603780 4:52566988-52567010 TCAGATAAGAAAGATGTTTCTGG - Intergenic
974128426 4:57723666-57723688 TAAAGTAGCAAACAAGTTTCTGG - Intergenic
974539643 4:63217911-63217933 TAAGTTGGAAAATATATTTCAGG - Intergenic
975185606 4:71398856-71398878 TATAGTAGAAGAGATGGTTCTGG + Intronic
976907764 4:90261681-90261703 AAAGTTTGAAAAGATATTTCAGG - Intronic
979522141 4:121679687-121679709 GTAGGTAGAAAAGATATTTTTGG - Intronic
980665263 4:135925302-135925324 TAAGGTAAGAAAAATGGTTCAGG + Intergenic
981364817 4:143890199-143890221 TACGGAAGAACAGATGGTTCTGG + Intronic
981375315 4:144008470-144008492 TACGGAAGAGAAGATGGTTCTGG + Intronic
981636690 4:146889207-146889229 TGAGGTAGACAATATGTTTTGGG - Intronic
982178407 4:152728058-152728080 TAAGGTAGATATTATGTTTGGGG + Intronic
982611433 4:157578796-157578818 TAAGGTAGGAAAGAGGTCTTTGG - Intergenic
983411186 4:167400290-167400312 TAAGGTACATACTATGTTTCAGG - Intergenic
983456655 4:167973484-167973506 CAACTTAGAAAACATGTTTCAGG + Intergenic
984543106 4:181066097-181066119 TAAGTTACTAAAGATATTTCAGG - Intergenic
984866763 4:184287583-184287605 TGAGGTAGAAAAGATTATTCAGG - Intergenic
985586832 5:744572-744594 TAAGTTAAAAATCATGTTTCAGG + Intronic
985601411 5:836758-836780 TAAGTTAAAAATCATGTTTCAGG + Intronic
987429789 5:17818660-17818682 TAAAGTTGAAAAGGTGTTTTCGG - Intergenic
987875080 5:23671564-23671586 TAAGGTGGAAATTATCTTTCTGG - Intergenic
989685233 5:44077958-44077980 TAAAATAGAAAATATTTTTCTGG - Intergenic
990644180 5:57825126-57825148 TAAAGTAGAAAAGCAGTTGCTGG + Intergenic
990897429 5:60714497-60714519 CAAGTTGGAAAACATGTTTCAGG - Intergenic
991655144 5:68896487-68896509 TAAGGTAGAAGAGATGCCTGTGG - Intergenic
992653940 5:78889833-78889855 TGGGGTAGAGATGATGTTTCAGG - Intronic
992920775 5:81516785-81516807 TAAGGTAAATAAGAAGTTTTTGG + Intronic
993895139 5:93524415-93524437 CAAGTTAGAAAACACGTTTCAGG + Intergenic
994131481 5:96234196-96234218 TATGGAAGAAAGGATGTATCAGG + Intergenic
994365324 5:98909593-98909615 TAATGAAGAAAAGATGTTTTGGG - Intronic
994836588 5:104862842-104862864 CCAGTTAGAAAAGATGTTCCTGG + Intergenic
994990434 5:106989589-106989611 GAAGGTAAAAATGATGTTTAAGG + Intergenic
996663791 5:126034589-126034611 TAATCTAGAAAAGATGTTAATGG + Intergenic
996941777 5:129015588-129015610 TAAGGAAGAAAGCATTTTTCAGG - Intronic
996957722 5:129204790-129204812 CCAGGTAGAGAAAATGTTTCTGG - Intergenic
998105873 5:139468949-139468971 TAAGCTATAACAGATGTTTAAGG + Intergenic
999185524 5:149704871-149704893 TAAAGTAGTAAAACTGTTTCAGG - Intergenic
1000138047 5:158372471-158372493 AAAGGTAGAAAAAATATTTCAGG - Intergenic
1000378502 5:160606876-160606898 AAAGCTAGAGAAGAAGTTTCTGG - Exonic
1000958252 5:167568211-167568233 TAATGTAGAAAAAATATTTTTGG + Intronic
1001043915 5:168356592-168356614 TAAGGTAGAAAGGATCCTTGTGG - Intronic
1001241951 5:170077913-170077935 AAAGGTAGAAGGGATGTTGCCGG - Intronic
1003052880 6:2796005-2796027 GAAACTAGAAAAGAGGTTTCTGG - Intergenic
1005417380 6:25614597-25614619 TAAGGTTGCATAGACGTTTCTGG + Intronic
1005942877 6:30574117-30574139 TAAAGTACAAAAGATTTTTTTGG + Intronic
1007491449 6:42225950-42225972 TTAGGAAGAAAAGATCTTTGGGG + Exonic
1007833297 6:44655383-44655405 TAAGGTAGATAAGAGTTTTGGGG - Intergenic
1008631909 6:53370205-53370227 TAAAGTAGAAAATATGTCACTGG - Intergenic
1008849662 6:56009981-56010003 TAAAGAAAAAAAAATGTTTCTGG + Intergenic
1010024356 6:71198556-71198578 TGAGGGAGAAAAGATGATTAAGG + Intergenic
1011213014 6:84974445-84974467 TAAAGTAGAGAAGATGCTTTAGG + Intergenic
1011361026 6:86525425-86525447 CAATGTAGAAAATATATTTCAGG - Intergenic
1011433890 6:87316905-87316927 GAAGTTAGAAAGGATGTTTCAGG - Intronic
1011815182 6:91181362-91181384 TAAGGCAAAAAAGCTGTTTGGGG - Intergenic
1013550434 6:111202476-111202498 TCAAGAAGAAAAAATGTTTCAGG + Intronic
1014242188 6:119029551-119029573 TAAGGTTGGAAAGATGTATGAGG + Intronic
1014518917 6:122414577-122414599 TAAGGTACAAAAAATGATTTGGG - Intronic
1014578143 6:123099875-123099897 TGAGGTAGACAAGAAGTCTCTGG - Intergenic
1014732068 6:125043984-125044006 TAAGGTAGTTAAGAAGTTGCAGG - Intronic
1015333902 6:132012759-132012781 TAATATATAAAATATGTTTCTGG + Intergenic
1015345561 6:132153544-132153566 AAATGAAGAAAAGATTTTTCAGG - Intergenic
1015465024 6:133539405-133539427 TGTGGTAGGAAAGATGGTTCTGG - Intergenic
1015881346 6:137873158-137873180 AAAGGAAGAAAAGATATTTAGGG + Intronic
1017388805 6:153915471-153915493 TAAGGGAAAAAAAATGATTCAGG - Intergenic
1018605897 6:165597489-165597511 TAAGGGAGAAAACATTTTTGTGG - Intronic
1019873546 7:3789446-3789468 TAAAGTAGAAAAGCAGTTACAGG - Intronic
1020480870 7:8658833-8658855 TGAGGTAGAATAGATGATTTTGG + Intronic
1020883850 7:13798013-13798035 CAAGGTAGCAAAGAGGTCTCTGG + Intergenic
1021021596 7:15605404-15605426 AAAGGAAGAAAATATGTTTAAGG + Intergenic
1021159670 7:17257185-17257207 TAAGGTAGAAAAGATGACGTGGG + Intergenic
1021666277 7:22984017-22984039 TAATTTGGTAAAGATGTTTCTGG + Exonic
1022804139 7:33804966-33804988 TAAGGTAGAATTGCTCTTTCTGG + Intergenic
1022873359 7:34502707-34502729 TAAGCTAGAAAAGAGCTTTCTGG + Intergenic
1024731000 7:52253742-52253764 AAAGGTAGCAAAGGTGTTTCTGG + Intergenic
1025739867 7:64185541-64185563 AAAGGAATAAAAGATATTTCTGG + Intronic
1027473285 7:78598807-78598829 AAAGTTAGTAAACATGTTTCTGG + Intronic
1028181315 7:87728778-87728800 TTAGGTAGAAAAGATGTAGTAGG - Intronic
1028412875 7:90550133-90550155 CAAGTTAGAAAACATGCTTCAGG - Intronic
1028435751 7:90801716-90801738 AAAGATAAAAAAGATGTATCTGG - Intronic
1028702755 7:93801087-93801109 TAAAGTAGAAAATATGATACAGG + Intronic
1031259903 7:119505832-119505854 TTAGGTAGAAAAGATGTAGTAGG - Intergenic
1032296283 7:130641746-130641768 TCAAATAGAAAAGTTGTTTCGGG + Intronic
1033722018 7:144070609-144070631 TAAGGTAAAATAGTTGTTTGTGG + Intergenic
1034769863 7:153763545-153763567 CAAGGAAAAAAAGATGTTGCTGG + Intergenic
1036539900 8:9696186-9696208 CAATGTAGAAAAGAGGTTTAAGG + Intronic
1038062537 8:23928895-23928917 TCAGTTAGAAAAGATGTTATGGG + Intergenic
1038589869 8:28826995-28827017 TAAGTTAGACAAGATGTGTTAGG - Intronic
1039285593 8:36037237-36037259 TAAAGCAGAAAAGATGATTTGGG + Intergenic
1039289504 8:36078592-36078614 CAACTTAGAAAACATGTTTCAGG + Intergenic
1040826758 8:51630340-51630362 TAACCTAGAAAATATGATTCTGG + Intronic
1040985723 8:53292110-53292132 TAAGATAGAAAAGATCTTAGAGG + Intergenic
1041142365 8:54836204-54836226 AAAGGGAGAAAAGATGTTGCAGG + Intergenic
1042435077 8:68754822-68754844 TGAGGTAGAACAAATTTTTCAGG + Intronic
1042513722 8:69637930-69637952 TGTGGTATAAAAGATGTTTGTGG + Intronic
1042516814 8:69667747-69667769 AAAGGTAGAAAAAATATTTCAGG - Exonic
1043252500 8:78092448-78092470 TTAGGTAGAAAAGATGGTGAAGG - Intergenic
1043518230 8:81016552-81016574 AAGGGTAGAAAATATATTTCAGG - Intronic
1043787252 8:84418897-84418919 TAAGATGGAAATGAGGTTTCAGG - Intronic
1043975320 8:86578871-86578893 TAAGAGAGAAAAGCTGTTTTAGG + Intronic
1044199892 8:89421803-89421825 TAGGGCAGAACATATGTTTCAGG + Intergenic
1046138143 8:110058173-110058195 CAATGTACAAAAGATGATTCCGG + Intergenic
1046313292 8:112467022-112467044 TAAAGTAGAAAAGAAGTTCAAGG + Intronic
1047378492 8:124330356-124330378 TCTGGTAGAGAAAATGTTTCCGG - Intronic
1050427776 9:5529589-5529611 CAAGGTATAAAAAATATTTCTGG - Intronic
1051904349 9:22078036-22078058 TGAGGGAGAAAAAAAGTTTCAGG - Intergenic
1052085212 9:24256608-24256630 AAAGGTATAAGAGATATTTCTGG + Intergenic
1052097960 9:24407906-24407928 TAAAGAAGAAAAGATGGTTGTGG + Intergenic
1052758402 9:32565669-32565691 GAAGGTACAAAAAATGATTCAGG + Intronic
1053067227 9:35077229-35077251 AAAGGTAGAAGAGATGAGTCAGG + Intronic
1053560195 9:39184521-39184543 TAAGTTAGAATAGATGTATTGGG + Intronic
1053824303 9:42004763-42004785 TAAGTTAGAATAGATGTATTGGG + Intronic
1054136923 9:61434434-61434456 TAAGTTAGAATAGATGTATTGGG - Intergenic
1054606271 9:67182600-67182622 TAAGTTAGAATAGATGTATTGGG - Intergenic
1055370334 9:75591702-75591724 AAACGTGGAAAAGATTTTTCTGG - Intergenic
1055620199 9:78117541-78117563 TAAGGTAGAATCAATTTTTCAGG - Intergenic
1056139448 9:83661089-83661111 TACAGTAGAAAAGCTGATTCTGG - Exonic
1057361509 9:94377679-94377701 TAAGGTAGAAAAAAGTTGTCAGG - Intronic
1057661851 9:97010494-97010516 TAAGGTAGAAAAAAGTTGTCAGG + Intronic
1058028822 9:100173425-100173447 TAAGTCAGAAGAGATGTTTCAGG + Intronic
1059518229 9:114915417-114915439 TGAGGTAGAAAAAATATTCCTGG - Intronic
1059637977 9:116189368-116189390 TAAGGTAGACATGATGTTATGGG - Intronic
1059783577 9:117555874-117555896 TATGGTAGAAAACATTTTTGTGG - Intergenic
1060444269 9:123673462-123673484 TTTGGCAGAAAAGATATTTCAGG + Intronic
1186358148 X:8809094-8809116 AAAGGTATCAGAGATGTTTCTGG + Intergenic
1188096730 X:26032685-26032707 TAATGAAGAAAAGATGTTTTAGG - Intergenic
1188318602 X:28707493-28707515 TAAAGTGTAAGAGATGTTTCTGG - Intronic
1188717218 X:33475053-33475075 TATACTAGAAAAGATGTTTAAGG - Intergenic
1188887627 X:35569633-35569655 TAATGGAGAGATGATGTTTCTGG + Intergenic
1188945316 X:36293726-36293748 TAATGGAGACATGATGTTTCTGG + Intronic
1189874022 X:45416467-45416489 TAAAGTGGAAAAGTGGTTTCAGG - Intergenic
1193206862 X:78759541-78759563 TCAGGAAGAAACGATATTTCTGG - Intergenic
1193272687 X:79547253-79547275 TAAGGTAGAAAACCTGTTCTGGG - Intergenic
1194307449 X:92265899-92265921 AAAGGTGCTAAAGATGTTTCTGG + Intronic
1194645902 X:96457786-96457808 TAAGGTGTAAAAGAATTTTCAGG + Intergenic
1195684453 X:107572927-107572949 TAAAGTAGAAAAGAATCTTCAGG + Intronic
1195900238 X:109789938-109789960 TATGGTAGAAAAGATGATTCAGG + Intergenic
1196239846 X:113330475-113330497 TAAAGTAGACAATATGTTTAAGG + Intergenic
1196323604 X:114373559-114373581 TATGGATGAAAAGAAGTTTCTGG - Intergenic
1197349620 X:125367941-125367963 TCAGGGAGAAAAGATTTTTAGGG + Intergenic
1197839059 X:130726042-130726064 TAAGGTATATACGATGTTCCTGG - Intronic
1198705553 X:139444635-139444657 CAAGTTGGAAAACATGTTTCAGG + Intergenic
1198764525 X:140067152-140067174 CAACGTTGAAAAGATGTCTCAGG - Intergenic