ID: 1093084149

View in Genome Browser
Species Human (GRCh38)
Location 12:14848094-14848116
Sequence AGTTACTTACATATCTAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 82}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093084149 Original CRISPR AGTTACTTACATATCTAGGG AGG Intronic
903872056 1:26442985-26443007 TGTTAGTTAGATATCTTGGGTGG + Intronic
904480327 1:30789262-30789284 TGTGACTTACACATCGAGGGGGG - Intergenic
904832345 1:33313083-33313105 AGGTACTTACTTATCCTGGGTGG + Intronic
909271670 1:73629600-73629622 AGTTACACAAATCTCTAGGGCGG + Intergenic
913515905 1:119605593-119605615 ATTTACTTACTTACCTGGGGGGG - Intergenic
917401852 1:174658423-174658445 AGTTAGTTACAAATATAGGAAGG - Intronic
917853487 1:179083910-179083932 AGTGACCTAAATATCTGGGGTGG - Intronic
920808690 1:209260573-209260595 ACTTATTTAAATATCTAGGTGGG + Intergenic
921899894 1:220439105-220439127 AGTTACTTGCTTAACTAGGATGG + Intergenic
1068798851 10:61116192-61116214 AGTTAATTATATATCCAGGTAGG - Intergenic
1070860592 10:79656033-79656055 AGTTCCTTACATATGTAATGAGG - Intergenic
1070876675 10:79819516-79819538 AGTTCCTTACATATGTAATGAGG + Intergenic
1073942320 10:108713026-108713048 AGTTCCATAGATCTCTAGGGTGG - Intergenic
1079826895 11:25207264-25207286 AGTTTCACAAATATCTAGGGCGG - Intergenic
1089858958 11:121572009-121572031 AGTTTATTACATATCTGGGTGGG + Intronic
1090549374 11:127802998-127803020 AGTCACTTTAGTATCTAGGGTGG + Intergenic
1090993085 11:131838361-131838383 AGTGATTTACATATCTATGGGGG + Intronic
1093084149 12:14848094-14848116 AGTTACTTACATATCTAGGGAGG + Intronic
1094265467 12:28554445-28554467 GGTTACATACATATCAATGGAGG - Intronic
1096904855 12:54926121-54926143 AGTTCCACAAATATCTAGGGCGG - Intergenic
1100047313 12:90398631-90398653 AGTCAATTACATATCTTGGCAGG + Intergenic
1100113861 12:91278586-91278608 AGTCACTCACATGTCTAGGTTGG - Intergenic
1105609514 13:21955685-21955707 AGTTCCACAAATATCTAGGGTGG + Intergenic
1108231428 13:48346831-48346853 AGTAACTTACATTTGTAAGGAGG + Intronic
1109910438 13:68904449-68904471 AGTGGCTTACATCTCTGGGGAGG - Intergenic
1119183359 14:72619106-72619128 AGTTCCGTACATATCGGGGGAGG + Intergenic
1124893051 15:33750328-33750350 ACGTAATTAAATATCTAGGGAGG - Intronic
1129655477 15:77521855-77521877 AGTTACCTACAGAGGTAGGGTGG + Intergenic
1130241268 15:82194736-82194758 ATTTATTTTCATAACTAGGGAGG - Intronic
1133503463 16:6387442-6387464 AAGTCCTTTCATATCTAGGGTGG - Intronic
1134194122 16:12145503-12145525 AATTACTTTCATATGCAGGGGGG - Intronic
1136157878 16:28396976-28396998 AGTTATTTACATATATATGATGG - Intronic
1136205209 16:28718307-28718329 AGTTATTTACATATATATGATGG + Intronic
1137250742 16:46738774-46738796 GGTTACTTACATATCAGGGGAGG + Intronic
1139306518 16:65990926-65990948 AGTTTCTTACATATAGAGTGGGG + Intergenic
1139574564 16:67832877-67832899 TGTTACTTTCATGTCTGGGGTGG - Intronic
1143501206 17:7340413-7340435 AGTTTCTTACTCATCTAAGGGGG + Intronic
1155425103 18:25698722-25698744 AGATACATACATATGTAGGCAGG + Intergenic
1156941291 18:42769786-42769808 GGTTACTTACATATGTATGGTGG - Intronic
925946270 2:8866818-8866840 AGATACTTACAAATTTAGAGGGG - Intronic
928752511 2:34487234-34487256 AATTATTTTCATTTCTAGGGAGG - Intergenic
932549166 2:72749590-72749612 ATTTAATTAAATATGTAGGGTGG - Intronic
939667313 2:144967401-144967423 AGTTATTTACAAATCCAGGATGG - Intergenic
946646515 2:221842755-221842777 AGTTTTTTACATTTCAAGGGAGG + Intergenic
1168781657 20:496810-496832 ATTTACTTACATTTCTAAAGTGG - Intronic
1172108918 20:32534047-32534069 AGTTACATACTTATCAAGGTGGG + Intronic
1172723232 20:37015376-37015398 TGTTGCTTACCTATCCAGGGTGG - Intronic
1182011434 22:27003931-27003953 ATTTAGTTACATATCTCTGGTGG - Intergenic
1182870025 22:33637913-33637935 AGTAACTAACATATACAGGGAGG + Intronic
952156246 3:30646750-30646772 GGTTTCTTAAATATCTACGGTGG + Intronic
954874699 3:53794301-53794323 ACTTACTAACAGTTCTAGGGTGG + Intronic
957613891 3:82505049-82505071 AGTTATTTTCATATATAGGGTGG - Intergenic
957694121 3:83611684-83611706 AATCATTTACTTATCTAGGGTGG + Intergenic
959390044 3:105762021-105762043 AGTTACACAGATCTCTAGGGTGG - Intronic
962048415 3:131786006-131786028 GGTAACTTCCATATCTATGGAGG + Intronic
965454924 3:168887698-168887720 TTTTACTTTCATATCCAGGGAGG - Intergenic
965565121 3:170107781-170107803 AGATAGTTACATATGTAGGGTGG - Intronic
975570291 4:75810052-75810074 ATTTATCTACCTATCTAGGGTGG + Intronic
975884768 4:78951766-78951788 AGATTCTTACATATCTGGAGGGG + Intergenic
976664206 4:87572547-87572569 AGCTATTCACATAACTAGGGTGG - Intergenic
980603409 4:135057265-135057287 AATTAAGTACATATCTAGGAAGG + Intergenic
981230797 4:142352927-142352949 AGTCACTTAGAAATATAGGGTGG + Intronic
984911017 4:184674201-184674223 ATTTATTTACATATCCAGAGAGG + Intronic
986114302 5:4754955-4754977 AGTTCAGTACATATCTAGGAGGG + Intergenic
990548481 5:56848297-56848319 AGTTACTTACATATCCCTAGAGG + Intronic
990697393 5:58435911-58435933 AAGAACTTGCATATCTAGGGAGG - Intergenic
994749691 5:103722247-103722269 AGTTTCATAGATCTCTAGGGTGG + Intergenic
994988850 5:106972583-106972605 AAATACTTACATATGTAGGGAGG - Intergenic
997117412 5:131139942-131139964 AATTACTTGCATATTTTGGGGGG - Intergenic
1000515389 5:162232287-162232309 AGTTCCATAAATCTCTAGGGTGG - Intergenic
1004067365 6:12261926-12261948 AGTCCCTTAGATAACTAGGGAGG + Intergenic
1005701063 6:28400549-28400571 AGTTGCATACGTATTTAGGGAGG - Intergenic
1006632339 6:35438260-35438282 AGTTACTTTCCTGTCTAAGGGGG + Intergenic
1010258721 6:73790478-73790500 AGATACTTACATATAAAAGGAGG + Intronic
1015445877 6:133304241-133304263 AATTACTTAATTATCTAGTGGGG + Intronic
1016074611 6:139780728-139780750 AGTTACTTACCTCTCTGGGCAGG - Intergenic
1027482037 7:78710014-78710036 AGTTACTAACATATCCAGGAGGG + Intronic
1031327158 7:120416001-120416023 AGTTACTCAGATATCTCTGGAGG - Intronic
1032574670 7:133040541-133040563 AGTTACTGAGATATATAGAGGGG - Intronic
1033580385 7:142727230-142727252 AGTTCCATAAATCTCTAGGGTGG + Intergenic
1036204700 8:6796560-6796582 AGTTTCTTGCAAAACTAGGGTGG - Intergenic
1038135872 8:24785071-24785093 AGATACATATATATCTATGGCGG - Intergenic
1044975706 8:97663395-97663417 ATATACTTACATATCTAGTAGGG + Intronic
1048153824 8:131921773-131921795 AGTGACTGAAATATCAAGGGAGG + Intronic
1049983871 9:930170-930192 TGTTACTTACATAGCTATAGAGG + Intronic
1188669149 X:32861851-32861873 ATTTGCTTCCATGTCTAGGGTGG - Intronic
1196916705 X:120543641-120543663 AGTTACTAACATGTTTAGGATGG + Intronic
1197632968 X:128883445-128883467 AGTTACTGCCACCTCTAGGGTGG + Intergenic
1197901028 X:131372239-131372261 AGTGATTTACAAATGTAGGGAGG + Intronic
1197922206 X:131607321-131607343 TGTCCCTTACATATGTAGGGAGG - Intergenic