ID: 1093084256

View in Genome Browser
Species Human (GRCh38)
Location 12:14849099-14849121
Sequence ACAAAGAAGCTACAGCTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 236}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093084256_1093084261 22 Left 1093084256 12:14849099-14849121 CCACTCAGCTGTAGCTTCTTTGT 0: 1
1: 0
2: 0
3: 17
4: 236
Right 1093084261 12:14849144-14849166 CACTGTCTGTTACTGTTCCTGGG 0: 1
1: 0
2: 0
3: 25
4: 177
1093084256_1093084263 26 Left 1093084256 12:14849099-14849121 CCACTCAGCTGTAGCTTCTTTGT 0: 1
1: 0
2: 0
3: 17
4: 236
Right 1093084263 12:14849148-14849170 GTCTGTTACTGTTCCTGGGGAGG 0: 1
1: 0
2: 0
3: 7
4: 149
1093084256_1093084258 -4 Left 1093084256 12:14849099-14849121 CCACTCAGCTGTAGCTTCTTTGT 0: 1
1: 0
2: 0
3: 17
4: 236
Right 1093084258 12:14849118-14849140 TTGTGAAGGAAAACATAGCCTGG 0: 1
1: 0
2: 4
3: 24
4: 251
1093084256_1093084260 21 Left 1093084256 12:14849099-14849121 CCACTCAGCTGTAGCTTCTTTGT 0: 1
1: 0
2: 0
3: 17
4: 236
Right 1093084260 12:14849143-14849165 TCACTGTCTGTTACTGTTCCTGG 0: 1
1: 0
2: 1
3: 21
4: 362
1093084256_1093084265 30 Left 1093084256 12:14849099-14849121 CCACTCAGCTGTAGCTTCTTTGT 0: 1
1: 0
2: 0
3: 17
4: 236
Right 1093084265 12:14849152-14849174 GTTACTGTTCCTGGGGAGGTGGG 0: 1
1: 0
2: 0
3: 13
4: 189
1093084256_1093084262 23 Left 1093084256 12:14849099-14849121 CCACTCAGCTGTAGCTTCTTTGT 0: 1
1: 0
2: 0
3: 17
4: 236
Right 1093084262 12:14849145-14849167 ACTGTCTGTTACTGTTCCTGGGG 0: 1
1: 0
2: 0
3: 16
4: 182
1093084256_1093084264 29 Left 1093084256 12:14849099-14849121 CCACTCAGCTGTAGCTTCTTTGT 0: 1
1: 0
2: 0
3: 17
4: 236
Right 1093084264 12:14849151-14849173 TGTTACTGTTCCTGGGGAGGTGG 0: 1
1: 0
2: 1
3: 23
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093084256 Original CRISPR ACAAAGAAGCTACAGCTGAG TGG (reversed) Intronic
901937599 1:12637192-12637214 ACACAGAAAGTACAACTGAGGGG - Intergenic
903522486 1:23961443-23961465 ACAAAGAAGCTGAAGATGGGTGG + Exonic
905043100 1:34976561-34976583 ACGAAGAAGCAGCAGATGAGTGG + Intergenic
907100374 1:51828101-51828123 ACATATAAACTACACCTGAGTGG + Intronic
907586825 1:55626044-55626066 ACAAAAAAGAAACAGCAGAGGGG - Intergenic
908896922 1:68911180-68911202 ACCAAGGAGTTCCAGCTGAGTGG - Intergenic
910133415 1:83936836-83936858 ACCAATAAGCTGCTGCTGAGTGG + Intronic
912102459 1:106227799-106227821 ACAAAGAAGTTATCTCTGAGTGG + Intergenic
913342972 1:117778499-117778521 ACAAAGAAGCTGAAGATGGGTGG - Intergenic
913566553 1:120078487-120078509 GGAAAGAGGCTACAGCAGAGAGG - Intergenic
914287311 1:146239199-146239221 GGAAAGAGGCTACAGCAGAGAGG - Intergenic
914548343 1:148689941-148689963 GGAAAGAGGCTACAGCAGAGAGG - Intergenic
914618338 1:149381767-149381789 GGAAAGAGGCTACAGCAGAGAGG + Intergenic
915023868 1:152807690-152807712 ATAAAGAAGTTACAGTTGAATGG - Intronic
917705626 1:177631358-177631380 ACACAGCAGCTGCCGCTGAGAGG + Intergenic
921421865 1:214957871-214957893 ACAAAAAACCCACAGCTGAGAGG - Intergenic
921684923 1:218079053-218079075 GCAAAGAAACTCCAGCTGAATGG + Intergenic
921799644 1:219387391-219387413 ACACAGCAGTTACAGGTGAGGGG - Intergenic
923937749 1:238782419-238782441 ACAAAGAAGTTAAAGGTAAGGGG - Intergenic
1063085537 10:2814707-2814729 ACAAAGAAGTCACTGCTCAGGGG - Intergenic
1063294596 10:4791772-4791794 ACAAAAAAATTACAGTTGAGTGG + Intronic
1065275158 10:24078358-24078380 AGAAAGAACGTGCAGCTGAGAGG + Intronic
1066379793 10:34891441-34891463 ATAAAGCAGCTTCTGCTGAGAGG - Intergenic
1066976640 10:42374622-42374644 ACAAAAAAGATACAGCTGTCAGG + Intergenic
1068711177 10:60135691-60135713 ACAAAGAAGATACACATAAGAGG + Intronic
1070578487 10:77699276-77699298 ACAAAGAAGGTACAAATGTGTGG + Intergenic
1070976520 10:80609812-80609834 ACAAAGAAGATGCCTCTGAGGGG - Intronic
1072794039 10:98340629-98340651 GCAAAGGAGATAGAGCTGAGGGG - Intergenic
1074101327 10:110356891-110356913 AGAAAAAAGCAACACCTGAGAGG + Intergenic
1074468331 10:113704718-113704740 CCAAAGAACTTAAAGCTGAGGGG - Intronic
1074754428 10:116613891-116613913 ACAAAGAACCACAAGCTGAGGGG + Intergenic
1076092500 10:127699915-127699937 ACAAAGCAGGTCCAGCTGGGTGG - Intergenic
1076505256 10:130968491-130968513 ATAAAGAAGCTCCATTTGAGAGG - Intergenic
1079109822 11:17599074-17599096 ACTGAGAATCTGCAGCTGAGGGG + Intronic
1080968856 11:37246222-37246244 ACAAAGCAGCTCCAACTGGGTGG - Intergenic
1082798461 11:57395813-57395835 ATAACGAAGGTACAGCAGAGAGG + Intronic
1083773977 11:64884172-64884194 GTAAAGAAGCTGCAGGTGAGAGG - Intronic
1084502488 11:69543126-69543148 ACAAAGAAGACACAGCTCACGGG + Intergenic
1085074491 11:73578178-73578200 ACGATCAAACTACAGCTGAGAGG + Intronic
1085626373 11:78076844-78076866 ACAAAGGAGATACAGTTGGGAGG - Intronic
1086858190 11:91892143-91892165 GCAAAGATGCTAAAGATGAGAGG + Intergenic
1088337482 11:108722668-108722690 ATAAGGAAGCTGAAGCTGAGAGG + Intronic
1088819054 11:113441695-113441717 AAAAAGAAGCTACACCTTGGTGG + Intronic
1089432416 11:118435592-118435614 ACAACGAAGCTGAAGCTGGGTGG - Intergenic
1090253580 11:125267483-125267505 AGGAAGAAGCTACTGCTTAGAGG + Intronic
1091318407 11:134632408-134632430 ACAAAGAAGCTTGAGCTGCTAGG - Intergenic
1091858410 12:3757166-3757188 ACAAAGAAGTTACAGATGACAGG - Intronic
1092146024 12:6215204-6215226 ACAAAGCACCTCCAGCTCAGAGG + Intronic
1093084256 12:14849099-14849121 ACAAAGAAGCTACAGCTGAGTGG - Intronic
1094064607 12:26349943-26349965 ATAAAAAAGCTACAGCTGGAAGG + Intronic
1094306531 12:29026134-29026156 ACTAAGAAGATAAAGTTGAGCGG + Intergenic
1096202777 12:49697403-49697425 ACAAAGGAGGTACAGATAAGTGG + Intronic
1097984641 12:65770538-65770560 ACAAAGAGGCACCAGCTGTGAGG + Intergenic
1098243330 12:68489931-68489953 ACAAGGAAGCTAGACCTTAGAGG + Intergenic
1098899509 12:76098648-76098670 ACAATTAAGCTACAGCCTAGTGG + Intergenic
1100039821 12:90302020-90302042 ATAAAGAATCTACAGCCCAGAGG - Intergenic
1100594161 12:96057168-96057190 ACTAAGGAGCTACAGTTCAGAGG + Intergenic
1101075034 12:101120104-101120126 ACAAAGCAGAGACAGCAGAGAGG - Intronic
1101783588 12:107861763-107861785 ACAGACAAGCAAAAGCTGAGAGG + Intergenic
1101852395 12:108414394-108414416 AGAGAGAAGCTACAGCTGCATGG - Intergenic
1102496677 12:113324388-113324410 AAAAAAAAGGTAGAGCTGAGTGG - Intronic
1103314441 12:120041150-120041172 ACAAATAAGGTAAAACTGAGAGG + Intronic
1106231774 13:27826226-27826248 ACAAAGCAGCTGAAGCTCAGAGG - Intergenic
1110623832 13:77629389-77629411 ACAAAGAAGCCAAAACTGAGAGG - Intronic
1110764302 13:79265392-79265414 ATAAAAAAGCTACAGGTGAGGGG + Intergenic
1112645573 13:101327822-101327844 AAAAAGAAGCTTGGGCTGAGTGG + Intronic
1117492900 14:56269950-56269972 ACAAAGAAGCTAGATCTGGTTGG - Intronic
1119399473 14:74352533-74352555 ACAAAAAAGCTACATTTGAAAGG - Intronic
1119495747 14:75077337-75077359 GCAAAGGAGGTACTGCTGAGAGG - Intronic
1121125703 14:91405339-91405361 ACCAAAAAGCCACAGGTGAGAGG + Intronic
1122784597 14:104157913-104157935 AGAAGGAGGCTGCAGCTGAGGGG - Exonic
1123778489 15:23603245-23603267 ACAAACAAGGTTCAGGTGAGAGG + Intronic
1124129757 15:26972918-26972940 AGAAAGAAACTTCAGCTGAAAGG - Intronic
1124454293 15:29826631-29826653 AGAAAGAGGACACAGCTGAGAGG - Intronic
1129608245 15:77035195-77035217 CCAATGAAGCTACAGCTTCGGGG + Intronic
1129665638 15:77578035-77578057 ACGAGGAAGCAAGAGCTGAGGGG + Intergenic
1131612955 15:93984185-93984207 ACCAAGAACCTGCAACTGAGTGG - Intergenic
1132343167 15:101090751-101090773 GCAAAGACTCCACAGCTGAGAGG - Intergenic
1136034070 16:27525454-27525476 ACAAAGAAGGAACAGCTGGGAGG - Intronic
1136083680 16:27869196-27869218 AGAAAAAGGCTACAGGTGAGTGG + Intronic
1136361651 16:29784379-29784401 ACATAGAAAGTACACCTGAGTGG - Intergenic
1138549807 16:57741212-57741234 ACACACAAGCAGCAGCTGAGAGG + Intronic
1138820477 16:60253686-60253708 AAAAAGTAGGTACAGCTGAAAGG + Intergenic
1140172488 16:72620860-72620882 ACAGAGAAGCTAAAGCCAAGTGG + Intergenic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1142245505 16:88968388-88968410 ACGAGGAAGCCCCAGCTGAGGGG + Intronic
1142863090 17:2775449-2775471 ATAAAGAAGCTGCTGGTGAGAGG + Intergenic
1143766554 17:9141522-9141544 GCAAAGAAGATGCAGCAGAGTGG + Intronic
1146903315 17:36601947-36601969 AAACAGAAGCTCCAGCCGAGAGG - Exonic
1147494141 17:40899849-40899871 ACTAAGAAGCTACACCTCACTGG - Intergenic
1148626440 17:49072916-49072938 AAAAAGCAGCTACTGATGAGTGG - Intergenic
1150363126 17:64555660-64555682 ATAAAGAAGCTACAGGAAAGGGG + Intronic
1150426306 17:65079669-65079691 ACAAAGAACCAAAAGCTGAGAGG + Intergenic
1150559580 17:66282915-66282937 GCAGAGGCGCTACAGCTGAGGGG + Intergenic
1151099950 17:71545311-71545333 ACAAAGAACCTACAAGAGAGGGG + Intergenic
1151528338 17:74686934-74686956 ACAAAGAAGCAACAGGTCACAGG - Intronic
1151685938 17:75646644-75646666 TCAAAGAAGCAACTGTTGAGAGG - Exonic
1154505729 18:15039135-15039157 ACAAAGAAGCTACAGTGTAACGG + Intergenic
1157500041 18:48183902-48183924 GTAAAGAAGCAAGAGCTGAGTGG - Intronic
1157815499 18:50726910-50726932 ACAAGGAAGCTTCAGCTGCAAGG + Intronic
1158108174 18:53908693-53908715 ACAAAGAACAAGCAGCTGAGAGG + Intergenic
1158935374 18:62359947-62359969 CCAAGGAAGGTACAGCTGTGGGG - Exonic
1159039697 18:63312225-63312247 AACAAGGAGCTACACCTGAGAGG + Intronic
1161808214 19:6457393-6457415 CCAAGGAGGATACAGCTGAGAGG - Intronic
1162764378 19:12909528-12909550 ACAAAGAAGGTAGAAATGAGGGG - Intronic
1163257907 19:16168664-16168686 TCACAGAAGCTAAAGCTGAGTGG + Intronic
1163578101 19:18122411-18122433 CCCCAGAAGCTACAGCTCAGAGG + Intronic
1165856872 19:38884331-38884353 ACAAGGATGCCACATCTGAGGGG - Intronic
1167507760 19:49880152-49880174 ACAAAGAAGGTACAGCAGGCCGG - Intronic
1168101424 19:54143502-54143524 ATTAAGAAGCTACAAGTGAGGGG + Exonic
926189435 2:10717172-10717194 AAAAAGAAAATACAGATGAGAGG + Intergenic
927112406 2:19873100-19873122 ACAAAGAGGCAGCAGATGAGAGG - Intergenic
928077024 2:28274178-28274200 ACAAAGAGGCCAAGGCTGAGTGG - Intronic
928900069 2:36308174-36308196 AGGAAGAAGCCACAGATGAGAGG - Intergenic
929922502 2:46182509-46182531 AAACAGAACCTATAGCTGAGGGG - Intronic
930403540 2:50923939-50923961 ACAGAGAGGCTACAGTTCAGAGG - Intronic
931049226 2:58391574-58391596 ACAAAGGAGACACAGCTAAGGGG + Intergenic
931839776 2:66136113-66136135 ACAAAGAAGCTAGAGGTAAAGGG + Intergenic
932024654 2:68120935-68120957 ACACAGAAGCCTCAGCTAAGGGG - Intergenic
933636961 2:84719237-84719259 ACAAACAAGCTAAAGCAGAGAGG - Intronic
934818295 2:97349278-97349300 GCAAAGATACTACAACTGAGGGG - Intergenic
936058403 2:109278782-109278804 ACAAACAAGATACAGGTGAAGGG - Intronic
937999931 2:127725053-127725075 AGAAAGAAGCCACAGGTCAGTGG - Exonic
938504917 2:131869416-131869438 ACAAAGAAGCTACAGTGTAACGG + Intergenic
941275991 2:163491406-163491428 ACACAGAAGAAAGAGCTGAGAGG - Intergenic
941654304 2:168126754-168126776 TCAAAGAACCTACAGGTGAGGGG + Intronic
942406964 2:175666427-175666449 ATAAAGAAGATACAGATGGGAGG + Intergenic
942594526 2:177580391-177580413 ACAAGGATGTTACAGCAGAGAGG - Intergenic
943666538 2:190615241-190615263 ACCGAGAAGCTACAGATCAGAGG + Intergenic
944173850 2:196807787-196807809 AGAAAGAAGGTACAGAGGAGGGG - Intronic
946256340 2:218444986-218445008 ACATAGCAGCCACAGCTGTGAGG + Intronic
948136749 2:235642291-235642313 ACAAAGAAACTTGAGGTGAGGGG + Intronic
948274278 2:236696181-236696203 ACAAAGGAGCCACAGGGGAGGGG - Intergenic
1169076469 20:2762916-2762938 ACAGAGGAGGTACAGATGAGGGG + Intergenic
1169771948 20:9210567-9210589 ACAACTCAGCCACAGCTGAGAGG - Intronic
1170049743 20:12129212-12129234 ACAAAGCAGCTCCAACTGGGTGG - Intergenic
1176048311 20:63103773-63103795 CCCAAAAAGCTACAGCTGGGTGG - Intergenic
1176792132 21:13329891-13329913 ACAAAGAAGCTACAGTGTAACGG - Intergenic
1177991527 21:28040878-28040900 ACAAAGAAGCTACAGTGTAATGG - Intergenic
1178708889 21:34896830-34896852 CCAAAGGAGCTTCAGTTGAGTGG + Intronic
1179346623 21:40564415-40564437 ACAAAGAAGCTAGAGGGAAGAGG + Intronic
1181433279 22:22895616-22895638 CCACAGAAGCTACAGCTGCCAGG + Exonic
1181434296 22:22901217-22901239 CCACAGAAGCTACAGCTGCCAGG + Intergenic
1181436800 22:22915854-22915876 CCACAGAAGCTACAGCTGCCAGG + Intergenic
1181438286 22:22922835-22922857 CCACAGAAGCTACAGCTGCCGGG + Intergenic
1183439646 22:37815973-37815995 ACACAGAAGCTAGAGGGGAGAGG - Intronic
1183533325 22:38376817-38376839 ACAAAAAAGTAACATCTGAGGGG + Intronic
1185067456 22:48639295-48639317 AAAAACAAGGTGCAGCTGAGGGG - Intronic
949517558 3:4821125-4821147 ACAGAGAAGGGACAGCTGATGGG + Intronic
949742555 3:7253077-7253099 AGCAAGGAGCTACAGTTGAGGGG + Intronic
950794583 3:15500506-15500528 TGAAACAAACTACAGCTGAGTGG - Intronic
951008349 3:17646353-17646375 ACAAAGAACCAAAAACTGAGTGG - Intronic
951646868 3:24901768-24901790 TCTAAGAAGCGACAGCTCAGAGG - Intergenic
952557844 3:34553628-34553650 AAAATGAAGCCACAGCTCAGGGG + Intergenic
953215851 3:40917390-40917412 ACAAAGAGGTTCCAGCTGAGGGG + Intergenic
953470986 3:43165919-43165941 ACAGGAAAGCTACGGCTGAGGGG + Intergenic
956056049 3:65300258-65300280 ACAAAGAACCACCAGCTGAGTGG + Intergenic
959347385 3:105215819-105215841 ACAAAGCAGATACAAATGAGTGG - Intergenic
960552037 3:118986661-118986683 AGAAGGAAACTACAGCTTAGAGG + Intronic
960601339 3:119462011-119462033 GCAAAGAAGGTAAAGCTGAACGG + Exonic
961761247 3:129169969-129169991 ACATAGAACATACAGTTGAGTGG - Intronic
962120180 3:132552922-132552944 ACCAAGGGGCTACAGCTGAGTGG + Intergenic
965923110 3:173943504-173943526 ACAAAGAGGAAACAGCTCAGAGG - Intronic
966471839 3:180298391-180298413 ACAAAGAAGCAAAAGCAAAGAGG + Intergenic
967066913 3:185926360-185926382 ATAAAGAAGCTAAAGCTGAAAGG + Intronic
967318281 3:188170985-188171007 ACAAGGAAGGTATTGCTGAGAGG - Intronic
968460336 4:721604-721626 ACAGAGAAGCTCCTGGTGAGCGG + Intronic
969093071 4:4710796-4710818 ACAAAAAAGATGCAGCTTAGCGG - Intergenic
969873483 4:10118863-10118885 GCAAAGATGATACAGATGAGGGG - Intergenic
970544310 4:17111783-17111805 AAAAAGAAGGTACTGCTGTGTGG + Intergenic
975378593 4:73672521-73672543 ACAAACAAAAAACAGCTGAGGGG - Intergenic
979553577 4:122019160-122019182 ACAAGGCAGCTTCAGCTCAGAGG + Intergenic
979737784 4:124109164-124109186 ATATAGAAGCTAAAGCAGAGAGG - Intergenic
981428534 4:144633302-144633324 TTAAAGAAGCAATAGCTGAGAGG + Intergenic
982124287 4:152171086-152171108 ACCAAGTCCCTACAGCTGAGTGG - Intergenic
983433484 4:167681393-167681415 ACAGAGAAGCAGGAGCTGAGTGG - Intergenic
983710997 4:170715128-170715150 AGAAAGAAGAAAGAGCTGAGTGG - Intergenic
984496728 4:180507320-180507342 ACAAAGAAAATAAAGTTGAGGGG + Intergenic
984878668 4:184391341-184391363 ACAAATAAGATACAGCAAAGGGG + Intronic
985770105 5:1804297-1804319 ACAAAGAATGTTCAGCAGAGAGG - Intronic
986113080 5:4739454-4739476 AGAAGGAAGTTACAGGTGAGAGG - Intergenic
986310583 5:6547895-6547917 ACACAGAAGCATCAGCTGAATGG + Intergenic
986396506 5:7336032-7336054 ATAAAGAAACTAAAGCTGTGAGG + Intergenic
987589261 5:19902445-19902467 ACAGAGGAGCTCAAGCTGAGGGG + Intronic
987713395 5:21533755-21533777 ACAAAGAAGCCACCACTGATAGG + Intergenic
988526000 5:31987927-31987949 CAAAAGGAGCTACAGTTGAGGGG - Intronic
989985817 5:50696778-50696800 AGAAAGAAGCAACAGATTAGGGG - Intronic
992983698 5:82204697-82204719 AAAAAGAAGCTACATTTAAGAGG + Intronic
993803266 5:92371897-92371919 ATAAATAAGCTAAAACTGAGAGG - Intergenic
997078655 5:130711883-130711905 ACAAAGAAGGTAGAGGTAAGAGG + Intergenic
997392084 5:133525361-133525383 ACAAAGAAGCTGCCTTTGAGTGG - Intronic
999287774 5:150404541-150404563 AGAAAGAAGTGAGAGCTGAGAGG + Intronic
999894997 5:156022933-156022955 ACAAAGAAGTGACAGCTGGGTGG - Intronic
1000832966 5:166126905-166126927 AAAAACAAGCCACAGATGAGTGG - Intergenic
1000858197 5:166426227-166426249 ACAAATAAGTTACAGGTGAAAGG + Intergenic
1001499643 5:172220337-172220359 ACAAAAAAGCTATAGCTGGCCGG + Intronic
1001768733 5:174276392-174276414 GCAAAGAAGTCACAGCAGAGAGG - Intergenic
1002675349 5:180908043-180908065 ACAAAGCAGCTCCAACTGGGTGG - Intronic
1004921871 6:20383436-20383458 ACAAAGTACCTAAAACTGAGTGG + Intergenic
1005186571 6:23168840-23168862 ACAAGGAGGCTACAGATGGGAGG - Intergenic
1007148101 6:39657862-39657884 ACAAAGGTGGTATAGCTGAGTGG - Intronic
1009003320 6:57748141-57748163 ACAAAGAAGCCACCACTGATAGG - Intergenic
1011215963 6:85005796-85005818 ACAAAGACTCTTCAGATGAGGGG + Intergenic
1012155552 6:95815413-95815435 ACTATGAAGATACAGCTGTGAGG + Intergenic
1012201365 6:96410380-96410402 AATAAGAAGCTACATCTGACTGG - Intergenic
1013859865 6:114622855-114622877 ACAAAGAGGGTACATATGAGTGG + Intergenic
1016023856 6:139264440-139264462 AGAAAGAAGGTACAGATGATAGG + Intronic
1017575062 6:155793089-155793111 ACAAATAAGGTAAAGATGAGAGG + Intergenic
1018758128 6:166867102-166867124 ACAAAGTATCACCAGCTGAGTGG - Intronic
1019145868 6:169975308-169975330 GGAAAGGAGCCACAGCTGAGGGG + Intergenic
1020553827 7:9643600-9643622 AAAAAGAATATTCAGCTGAGTGG + Intergenic
1022649455 7:32261122-32261144 GAAAAGAAACTACAGTTGAGGGG + Intronic
1022966458 7:35477963-35477985 ACAAAGAAGCAACAGCAAACAGG + Intergenic
1023410798 7:39887188-39887210 TCAAGGAAGCCACTGCTGAGAGG - Intergenic
1027405216 7:77853692-77853714 AAAAAAAATCTAGAGCTGAGTGG - Intronic
1028897406 7:96057681-96057703 CTTAAGAAGCTACAGCTCAGTGG - Intronic
1030780895 7:113598485-113598507 ATTAATAAGCCACAGCTGAGTGG - Intergenic
1033785160 7:144721527-144721549 AGAAAAAAGGTACAGGTGAGTGG - Intronic
1034058946 7:148068115-148068137 GCAAAGAAGCTACAGCAGGTGGG - Intronic
1035370089 7:158374157-158374179 AAACAGAATCTAGAGCTGAGGGG + Intronic
1035717839 8:1767359-1767381 ACAGGTAAGCCACAGCTGAGTGG - Intronic
1035923677 8:3705178-3705200 AGAAAGCAGCCACAGCTCAGTGG - Intronic
1036759646 8:11498563-11498585 ACAAAGCAGCCACATCTGAGTGG + Intronic
1037060597 8:14504780-14504802 ACAAAAAGGTTTCAGCTGAGGGG - Intronic
1037290029 8:17340604-17340626 ACAAAAAAGTTAAGGCTGAGTGG + Intronic
1037716888 8:21408399-21408421 ACAAATAAGCAACTGCTGAATGG + Intergenic
1039032045 8:33321294-33321316 TCAGAGAAGATACAGCTGAAGGG + Intergenic
1039223090 8:35357039-35357061 AAAAAGAAACCACAGATGAGGGG + Intronic
1039676941 8:39678490-39678512 ACAAAGAAAGTACTGATGAGTGG + Intronic
1041816915 8:61983791-61983813 ACAAAGAAGAGACAGATGATTGG + Intergenic
1042855380 8:73261534-73261556 CCCAAGAAGCTACTCCTGAGGGG + Intergenic
1043915085 8:85913234-85913256 AGAAAGAAGCCACAGATGATAGG - Intergenic
1046017040 8:108617588-108617610 CAAAAGAAGATATAGCTGAGGGG + Intronic
1048685783 8:136903990-136904012 AGAAAGAAGCTGCAGGTGTGAGG + Intergenic
1049678348 8:143903488-143903510 ACAAAGAAGGCATAGCTGAGGGG - Intergenic
1051925998 9:22326391-22326413 ACAAAGAAGCCTGAGCTGTGAGG + Intergenic
1052073652 9:24113953-24113975 AGAAAGATGCTACAGTTCAGAGG - Intergenic
1056276762 9:85001414-85001436 ACAAAGATGGTGGAGCTGAGAGG - Intronic
1056640287 9:88364470-88364492 ACAAAAAACCTACAGCTGCCAGG + Intergenic
1059275385 9:113092144-113092166 ACAAAGCAGCTGAAGCTGATGGG - Intergenic
1059279393 9:113119395-113119417 AGAGAGAAGCTAGACCTGAGGGG - Intergenic
1059567086 9:115393668-115393690 ACAAAGAAGCTACATTTTACTGG + Intronic
1059817295 9:117931643-117931665 AAAAAGAAGCTACAGATAATGGG - Intergenic
1060014474 9:120074685-120074707 ACAAAGAACCTACAGCTAAAAGG - Intergenic
1060695264 9:125704081-125704103 ACACTGAAGCTACAGCTCAAGGG + Intronic
1187022221 X:15395620-15395642 ACAAAGAAACTGAAGCTCAGAGG + Intronic
1187047315 X:15660045-15660067 AGAAAGTAGCAAAAGCTGAGCGG + Intronic
1192707313 X:73540585-73540607 AAAAAGAAGGTAGAGGTGAGGGG + Intergenic
1193082059 X:77415836-77415858 ACAAAGAAGACTCAGCAGAGAGG + Intergenic
1194553749 X:95332635-95332657 GCACAGAAGCTGCAGCTGGGAGG + Intergenic
1198804405 X:140479704-140479726 ACAGCTAAGCTAAAGCTGAGAGG + Intergenic
1199433817 X:147790096-147790118 ACAAAGAAGATACAGGGAAGCGG - Intergenic
1200297044 X:154930553-154930575 ACAAAAATGCTACAGCTTTGAGG - Exonic
1201890307 Y:18936611-18936633 TCAAAGAAGCCACATGTGAGTGG - Intergenic