ID: 1093084579

View in Genome Browser
Species Human (GRCh38)
Location 12:14852466-14852488
Sequence AAGAAGAAGGAGGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9570
Summary {0: 36, 1: 155, 2: 521, 3: 2021, 4: 6837}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093084579_1093084587 8 Left 1093084579 12:14852466-14852488 CCCTCCTCCTCCTCCTTCTTCTT 0: 36
1: 155
2: 521
3: 2021
4: 6837
Right 1093084587 12:14852497-14852519 AGGGTCTTGCTTTGTCACCCAGG 0: 389
1: 6160
2: 26529
3: 75963
4: 139529
1093084579_1093084588 12 Left 1093084579 12:14852466-14852488 CCCTCCTCCTCCTCCTTCTTCTT 0: 36
1: 155
2: 521
3: 2021
4: 6837
Right 1093084588 12:14852501-14852523 TCTTGCTTTGTCACCCAGGCTGG 0: 1626
1: 32255
2: 83255
3: 164733
4: 172146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093084579 Original CRISPR AAGAAGAAGGAGGAGGAGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr