ID: 1093088729

View in Genome Browser
Species Human (GRCh38)
Location 12:14896113-14896135
Sequence ACTTGTTTGGTGCTCTACCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 87}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093088729 Original CRISPR ACTTGTTTGGTGCTCTACCC GGG (reversed) Intronic
900089804 1:915083-915105 CCCTGCTTGGTGCTCTGCCCAGG - Intergenic
905272797 1:36797890-36797912 ACCTGTTTGGCCCTTTACCCTGG + Exonic
905288678 1:36906200-36906222 ACATGTGTGGTGCTCCACTCAGG + Intronic
908012471 1:59793273-59793295 GCTTGTTTTGTGGTCTATCCTGG - Intergenic
908213512 1:61926149-61926171 GTCTGTTTTGTGCTCTACCCTGG + Intronic
911373200 1:97019125-97019147 ACTTCTGTGGTGATCTATCCTGG - Intergenic
915640080 1:157217953-157217975 ACTTGTTCTGTCCTCTGCCCAGG + Intergenic
919120309 1:193331654-193331676 ACTTGTTTTGTGGTCTAACATGG + Intergenic
919808763 1:201396398-201396420 GCTTGTTTTGACCTCTACCCTGG + Intronic
920165530 1:204032989-204033011 ACTTGTTTGGCACTCAGCCCAGG - Intergenic
1066659654 10:37727660-37727682 ACTGGTTGGGTGCACTATCCCGG + Intergenic
1071233376 10:83615479-83615501 ACTTCTTTCTTGCTCCACCCAGG - Intergenic
1073205609 10:101767859-101767881 AGTTGATGGGTGCTCTAGCCTGG + Intergenic
1073864411 10:107785533-107785555 ACTTGCTTTGTGGTCTATCCTGG + Intergenic
1077304998 11:1865002-1865024 ACTTCCTTGGCGCTCTGCCCTGG - Intronic
1078868839 11:15325202-15325224 ACTTGTTGGGTCTTCCACCCAGG + Intergenic
1081792432 11:45797744-45797766 ACTTGCTGTGTGCTCTGCCCTGG - Intergenic
1082211002 11:49501300-49501322 ACTTGTTTTGTGGTCTAACATGG - Intergenic
1084119153 11:67058926-67058948 CCCTGTGTGGTGCTCTTCCCCGG - Intronic
1086638647 11:89123732-89123754 ACTTGTTTTGTGGTCTAACATGG + Intergenic
1088558454 11:111087549-111087571 AGTTGATGTGTGCTCTACCCAGG + Intergenic
1090117861 11:123994097-123994119 ACTTATTTGGTGTCCTATCCAGG + Intergenic
1093088729 12:14896113-14896135 ACTTGTTTGGTGCTCTACCCGGG - Intronic
1098527162 12:71499406-71499428 ACATGTGTGGTTCTCTTCCCTGG - Intronic
1100421533 12:94438763-94438785 ACTTGTTTTGTGGTCTATCTTGG - Intronic
1104723889 12:131063578-131063600 ACTTGTGTGGGGCTGTTCCCAGG + Intronic
1107721479 13:43252999-43253021 ACATGTTTGGTGGTCTTCCTGGG - Intronic
1108776258 13:53768734-53768756 ACTTGTTTATTCCTGTACCCTGG - Intergenic
1115513124 14:34157933-34157955 AATTGGTTGGTGCTCCACCTTGG + Intronic
1116392219 14:44406516-44406538 ACTTGTTTTGTGGTCTGTCCTGG - Intergenic
1117514833 14:56490449-56490471 TCTTCTTTGCTGCTGTACCCGGG + Intronic
1121689227 14:95863991-95864013 ACTTGTTTTCAGCTCTGCCCAGG - Intergenic
1122425259 14:101601937-101601959 CCATGTTTGGTGCTGGACCCGGG + Intergenic
1123702875 15:22928608-22928630 ACTTGTGTGTTGCCCTTCCCCGG - Intronic
1125432741 15:39612239-39612261 ACTTGTTTTGTGGCCTATCCTGG - Intronic
1130223956 15:82044376-82044398 ACTTGGATGGTGGTCTGCCCGGG + Exonic
1137429963 16:48410654-48410676 ACTGTTTTGGTGCTCTATTCGGG - Intronic
1137876349 16:51999967-51999989 TCTTGTTCACTGCTCTACCCGGG + Intergenic
1140982209 16:80121409-80121431 CCTTGTTTGTTTTTCTACCCTGG + Intergenic
1147038371 17:37698850-37698872 CCTTGTTTAGTGCTCTTCCTGGG + Intronic
1157371479 18:47116753-47116775 ACTTATTTGCTACTCTACCACGG + Intronic
1159496687 18:69216553-69216575 AGTGGTTTGGTGCTCCTCCCAGG - Intergenic
1162512295 19:11126765-11126787 ACTTGTATGGTTCTGTACCAAGG + Intronic
1163508698 19:17722972-17722994 CCTTGGCTGGTGCTGTACCCTGG + Intronic
1165666340 19:37632168-37632190 ATTTGTTTGTTGGTCTACTCAGG + Exonic
1166308781 19:41950685-41950707 TCTTGTTTGGTGATATAGCCTGG - Intergenic
927558734 2:24053928-24053950 ACGTGTGTGGTGCACTACACAGG + Exonic
930935320 2:56942497-56942519 TCTTGTTTGATGCTCTAGCTAGG + Intergenic
932997845 2:76878929-76878951 ACTGGTTTGATGTTCTATCCAGG - Intronic
938302590 2:130227801-130227823 GCTTTGTTGGTGCTCTGCCCAGG + Intergenic
938454092 2:131446453-131446475 GCTTTGTTGGTGCTCTGCCCAGG - Intergenic
939561444 2:143737066-143737088 ACTTGTTTGGGACTCTCTCCTGG + Intronic
940765923 2:157789415-157789437 TCTTGTTTGTTGCTCTCGCCTGG - Intronic
1170512997 20:17098169-17098191 ACATTTTTGGTGCTTTTCCCAGG - Intergenic
1174789605 20:53465073-53465095 ATTTGTCTGGAGCTCAACCCTGG - Intronic
1178508607 21:33183384-33183406 ACTTGTTTGTTGCTCCCCTCTGG + Intergenic
1180305053 22:11067119-11067141 GTTTGTTGGGTGCACTACCCCGG + Intergenic
1181600428 22:23948842-23948864 CCTTGTATGGTCCCCTACCCTGG + Intergenic
1184191834 22:42900112-42900134 ACTGGGTTGGTGCTCCACGCTGG - Intronic
953013549 3:39051748-39051770 ACTTGTGTGGTCCTAGACCCTGG - Intergenic
955909180 3:63842764-63842786 ACTTGTGTAGTACACTACCCGGG + Intronic
958938558 3:100285049-100285071 TTTTGTATGGTTCTCTACCCTGG + Intronic
959004321 3:101002915-101002937 TCTTGTTTGATGCTCTAGCCAGG + Intergenic
962021478 3:131506747-131506769 ACTGGTTTGGAGCTATACTCTGG - Intergenic
964242919 3:154616881-154616903 ACATGGTTGGTACACTACCCTGG - Intergenic
964683220 3:159365532-159365554 GCCTGTTTAGTGCTATACCCTGG + Intronic
964857763 3:161165467-161165489 TCTTGTTTGTTGCTCTAGCTCGG + Intronic
966328945 3:178789888-178789910 ACTTGGTGGGTGCACAACCCAGG + Intronic
967480292 3:189964882-189964904 GCTTGTTTGATCTTCTACCCTGG - Intronic
967798571 3:193627893-193627915 CCATGTTTGGTGCTCTACTCAGG - Intronic
967896068 3:194397047-194397069 ACGTGTTTGGGGCTCTGCCCCGG - Exonic
969090589 4:4691260-4691282 ACTTGCCTGGGTCTCTACCCAGG + Intergenic
973885534 4:55317242-55317264 ACTTCTTTGGTGCTCTCCTCAGG + Intergenic
973954127 4:56046706-56046728 ACATTTTTGGTGGTCTACACTGG - Intergenic
977454073 4:97235552-97235574 ACTTGCTTGGTGCTCCACTGTGG - Intronic
989561954 5:42862539-42862561 ACTTGTTTTGTGGTCTATCTTGG + Intronic
997879165 5:137574253-137574275 ACTTGCCTCCTGCTCTACCCTGG + Intronic
1000018578 5:157299977-157299999 TTTTGTTTCCTGCTCTACCCCGG + Intronic
1004466396 6:15889259-15889281 ATGTGTTTGGTGCTCTTCTCTGG - Intergenic
1008950285 6:57150803-57150825 ACTTTTTTGGTCATCTACCAGGG + Exonic
1017060316 6:150478022-150478044 ACTTGTTTTGTGGTCTAACATGG - Intergenic
1020253550 7:6488242-6488264 ACTTGTTTTGGGTACTACCCTGG + Intergenic
1024230369 7:47359037-47359059 AGTTGTTTGGGGCGTTACCCAGG - Intronic
1031285574 7:119862833-119862855 TTTTGTTTGGTGCTCTTCCCTGG + Intergenic
1044435319 8:92155703-92155725 ACTTGGTCAGTGCTCTATCCAGG + Intergenic
1046643289 8:116756374-116756396 ACTTCTTTGGTACTTTACTCAGG - Intronic
1059122562 9:111655380-111655402 AGTTGTGGGGTTCTCTACCCAGG - Intronic
1187756635 X:22534729-22534751 ACTTGTTTTGTTCTCTTCTCTGG + Intergenic
1190782166 X:53608307-53608329 ACTTTTTTGGTGAGATACCCAGG + Intronic
1192428661 X:71098109-71098131 ACTTGTTATTTCCTCTACCCTGG - Intronic
1194985854 X:100488940-100488962 ACTTGTTTGCCACTGTACCCCGG + Intergenic
1198778186 X:140204054-140204076 ACTTGTGTGGTGCTATATCTGGG - Intergenic
1200095815 X:153660927-153660949 ACTTGTTTTATGGTCTATCCTGG - Intergenic