ID: 1093089413

View in Genome Browser
Species Human (GRCh38)
Location 12:14904642-14904664
Sequence CCGTCTTTGCAGAAGATAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 191}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093089408_1093089413 -4 Left 1093089408 12:14904623-14904645 CCAGGGTACAGAAAGCCCTCCGT 0: 1
1: 5
2: 170
3: 216
4: 182
Right 1093089413 12:14904642-14904664 CCGTCTTTGCAGAAGATAAAGGG 0: 1
1: 0
2: 0
3: 11
4: 191
1093089407_1093089413 -3 Left 1093089407 12:14904622-14904644 CCCAGGGTACAGAAAGCCCTCCG 0: 1
1: 4
2: 117
3: 278
4: 318
Right 1093089413 12:14904642-14904664 CCGTCTTTGCAGAAGATAAAGGG 0: 1
1: 0
2: 0
3: 11
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093089413 Original CRISPR CCGTCTTTGCAGAAGATAAA GGG Intronic
906584706 1:46966036-46966058 CCGGCTTTGGAGAATACAAATGG - Intergenic
907672445 1:56488252-56488274 AGGTCTTAGCAGACGATAAATGG + Intergenic
911194967 1:94985027-94985049 CCCTTTTTGCAGAGGAGAAAAGG + Intronic
911286035 1:95994024-95994046 CCATCTTAGCAGAAGATACATGG + Intergenic
911465978 1:98252446-98252468 CAATCTTTGCAGAAGGTAAAAGG - Intergenic
911686119 1:100779792-100779814 CAATCTTTGCAGAAGGTGAAAGG + Intergenic
912900892 1:113647132-113647154 GTGTCTTTGAGGAAGATAAAAGG + Intronic
913034328 1:114947852-114947874 CAGTATTTGCAGAAAAAAAAGGG - Intronic
913215741 1:116618853-116618875 CCTTCTTTGCAGGAGATGTATGG - Intronic
915760963 1:158312361-158312383 CAGTCATGGCAGAAGGTAAAAGG - Intergenic
916380818 1:164208726-164208748 TAGCCTATGCAGAAGATAAATGG + Intergenic
916653045 1:166848694-166848716 CCTTCTTTGCAGATGAAGAAGGG - Intronic
917702379 1:177594451-177594473 CCTTGTTTTCAGAAGAAAAAGGG - Intergenic
920305567 1:205016143-205016165 CCTGCTTTGCAGAAGGGAAATGG - Intronic
920727874 1:208453881-208453903 GCTTCTTTGCAGAAGATATTGGG - Intergenic
923179571 1:231503162-231503184 CAGTCTTGGCAGAAGGTGAAAGG - Intergenic
923636818 1:235706335-235706357 CCCTCATTTCAGAAGACAAAGGG + Intronic
1063827455 10:9913456-9913478 TGGACTTTGCAGAAGAAAAATGG + Intergenic
1064010071 10:11728551-11728573 CGGTCATGGCAGAAGCTAAAGGG + Intergenic
1065894917 10:30154764-30154786 CAGTCATGGCAGAAGACAAAGGG + Intergenic
1067321272 10:45223426-45223448 ACGTCTTGGCAGAAGGAAAAGGG - Intergenic
1068147869 10:53093991-53094013 CAGTCATGGCAGAAGGTAAAGGG - Intergenic
1074212317 10:111347517-111347539 CCCTCTTTGTTGAATATAAATGG + Intergenic
1074946989 10:118289650-118289672 CCCTCTCTGGAGAAGACAAAAGG + Intergenic
1075421642 10:122305527-122305549 CCATCTTGGCAGAAGGTAAAGGG - Intronic
1075685507 10:124362625-124362647 CCACCTTTGCAGAAAATAGATGG + Intergenic
1083256826 11:61501673-61501695 CAGTCATGGCAGAAGGTAAAAGG + Intergenic
1085987006 11:81799939-81799961 CAGTCTTGGCAGAAGGTGAAGGG - Intergenic
1087497182 11:98906793-98906815 CCGTCATGGCAGAAGGTGAAGGG - Intergenic
1088367003 11:109050353-109050375 CCGTCTTTGAAGCTGATAACCGG - Intergenic
1089191810 11:116659248-116659270 CCAGCTTTGGACAAGATAAATGG - Intergenic
1091155828 11:133371641-133371663 CAATCATTGCAGAAGACAAAGGG - Intronic
1092885972 12:12924688-12924710 CCATCTCTACAAAAGATAAAAGG - Intergenic
1093089413 12:14904642-14904664 CCGTCTTTGCAGAAGATAAAGGG + Intronic
1093095991 12:14973029-14973051 CCTTCTTTGCAAAAGACAAAAGG - Exonic
1093194414 12:16112883-16112905 CACTCATAGCAGAAGATAAAGGG - Intergenic
1093765719 12:22959690-22959712 CCGTCATGGCAGAAGATGAAGGG - Intergenic
1094028013 12:25979615-25979637 CAGTTTTTGCAGAAGTAAAATGG - Intronic
1094095138 12:26695300-26695322 TCTTCTTTACAGAAGAAAAAAGG + Intronic
1094671570 12:32575330-32575352 CATTCATGGCAGAAGATAAAGGG + Intronic
1097521118 12:60672343-60672365 CCAGCTTTGGAGAATATAAATGG - Intergenic
1098832016 12:75374932-75374954 TGGCCTGTGCAGAAGATAAATGG - Intronic
1099269829 12:80494176-80494198 TCTTCTTTGCACAAGAAAAATGG - Intronic
1101521943 12:105492080-105492102 TCCTTTTTGCAGATGATAAAAGG + Intergenic
1105219468 13:18312329-18312351 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1105930615 13:25048625-25048647 CCCCATTTGCAGAAAATAAAAGG + Intergenic
1109494325 13:63147929-63147951 CAATCATGGCAGAAGATAAAGGG + Intergenic
1109958537 13:69601816-69601838 CAGTCTTGGCAGAAGGTGAAAGG + Intergenic
1111240417 13:85466225-85466247 CCATCATGGCAGAAGACAAAGGG + Intergenic
1113516774 13:110909062-110909084 CAGTATTTTCAGTAGATAAAGGG - Intronic
1116375225 14:44190799-44190821 CCGTCATGGCAGAAGCTGAAGGG - Intergenic
1116501305 14:45626158-45626180 CCTTCATTACAGAAGATCAAAGG + Intergenic
1116549132 14:46211730-46211752 CAGTCACTGCAGAAGACAAAGGG - Intergenic
1118766197 14:68910897-68910919 CAGTCATTGCAGAAGAGCAAGGG - Intronic
1119800552 14:77441202-77441224 CCCTCTATACACAAGATAAATGG + Intronic
1119810625 14:77515284-77515306 CCTTTTTTGCAGAAATTAAAAGG - Intronic
1121566035 14:94909926-94909948 CTGTCTTGGCAGAAGAGTAAGGG + Intergenic
1123826275 15:24085604-24085626 TGGCCTATGCAGAAGATAAATGG - Intergenic
1123890020 15:24768342-24768364 CAGTCATTAGAGAAGATAAATGG + Intergenic
1124643455 15:31415995-31416017 CCGACTTTACAGAAGTAAAAGGG + Intronic
1126044433 15:44625546-44625568 CAGTCATGGCAGAAGATGAAGGG - Intronic
1128738804 15:70069496-70069518 TCCTCTTTGCAAAAGAGAAAAGG + Intronic
1131342679 15:91617343-91617365 CAGTCATGGCAGAAGGTAAAGGG + Intergenic
1131563604 15:93465312-93465334 CCTTCTGTGTAGAAGAAAAAGGG - Intergenic
1132343107 15:101090370-101090392 CCGTCTTTGGAGAACATAATCGG - Intergenic
1133424645 16:5677421-5677443 CCCTGTTTACAGTAGATAAATGG + Intergenic
1133681556 16:8124792-8124814 CCTTCTTTGCAGAATATATGTGG - Intergenic
1135392512 16:22105472-22105494 CTGTGTCTGCAGAGGATAAAAGG + Intronic
1135849174 16:25947105-25947127 CCATCTTTTCAAAATATAAATGG - Intronic
1139030723 16:62877287-62877309 CAGTCATGGCAGAAGACAAAGGG - Intergenic
1150997249 17:70332644-70332666 CCCTCTTTTAAAAAGATAAATGG + Intergenic
1153372502 18:4334879-4334901 AAGTCTTTGGAGAAAATAAAAGG + Intronic
1154150276 18:11901108-11901130 CTGGCTTTTCAGAAGATGAAAGG + Intronic
1156464114 18:37337679-37337701 CCATTTGTGCTGAAGATAAAGGG - Intronic
1157663278 18:49464377-49464399 CTTTCTTTGTAGAAGCTAAAGGG + Intergenic
1158007938 18:52694629-52694651 CAGGCTTTGCTGCAGATAAAGGG + Intronic
1159838469 18:73369501-73369523 CCCTGGTTGCTGAAGATAAAGGG + Intergenic
1165804040 19:38569570-38569592 CCTGCTTTACAGAAGATGAAAGG - Intronic
1166384412 19:42372347-42372369 GCCTCTGTGCAGAAGAAAAAGGG - Intronic
925485733 2:4328272-4328294 CAGTCATGGCAGAAGGTAAAGGG + Intergenic
928132677 2:28664462-28664484 CCGTCTTTGCAGATGAACAGAGG + Intergenic
928883290 2:36121753-36121775 CTGTCTTTGCAGATGGAAAAGGG - Intergenic
933148052 2:78880491-78880513 CGGTACTGGCAGAAGATAAATGG - Intergenic
934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG + Intergenic
935453269 2:103235564-103235586 CAGTATTTGCAGGAAATAAAGGG + Intergenic
935568960 2:104638919-104638941 TGGTCTGAGCAGAAGATAAATGG + Intergenic
940576805 2:155518251-155518273 CTGTCTGTGCAGAAGTTAAATGG - Intergenic
942079702 2:172388406-172388428 ACGTCTTTGGAGATGATAGAAGG + Intergenic
943553319 2:189368684-189368706 CAGTCTTTGTACAACATAAATGG + Intergenic
945336728 2:208600940-208600962 CAGTCATGGTAGAAGATAAAGGG + Intronic
947076629 2:226352050-226352072 CGGCCCTTGCAGAAGCTAAATGG - Intergenic
948466299 2:238153313-238153335 CCGTCTTGGGAGAAGGGAAAGGG + Intergenic
948938423 2:241183530-241183552 CCGTCTTTGGAGAGGCTCAATGG - Exonic
1170876841 20:20257957-20257979 CCAACACTGCAGAAGATAAAAGG + Intronic
1171857505 20:30360907-30360929 CCTTCTCTGCAAAAAATAAAGGG + Intergenic
1172163446 20:32884541-32884563 CCATCTCTGCAGAAGAGCAAGGG - Intronic
1176184718 20:63771971-63771993 CCGTGTTTACAGAAAACAAAAGG + Intronic
1177327630 21:19612737-19612759 CCATCTTGGCAGAAGGTGAAGGG - Intergenic
1177882940 21:26715831-26715853 AAGTATTTGTAGAAGATAAAAGG + Intergenic
1178058900 21:28830399-28830421 CCGTCATGGCAGAAGGTGAAGGG - Intergenic
1180817070 22:18797189-18797211 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181203259 22:21231534-21231556 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181891810 22:26069821-26069843 CACTCATGGCAGAAGATAAAGGG - Intergenic
1184931703 22:47686178-47686200 CCTGTTTTGCAGAAGAGAAAAGG - Intergenic
1184994706 22:48197049-48197071 CAGTCATGGCAGAAGGTAAAAGG - Intergenic
1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG + Intergenic
1203267169 22_KI270734v1_random:22910-22932 CCTTCTTTGCAGGAGATGGATGG - Intergenic
950481726 3:13248261-13248283 CTGTCTATGAGGAAGATAAAGGG - Intergenic
951180803 3:19655945-19655967 CAATCATTGCAGAAGATGAAGGG + Intergenic
952212901 3:31247233-31247255 CAGTCTTGGAAGAAGAGAAAAGG - Intergenic
953686292 3:45080929-45080951 CCCTCATGGCAGAAGACAAAGGG - Intergenic
955035479 3:55263174-55263196 CTGTCTTTGCACAAGCCAAATGG - Intergenic
956956939 3:74352060-74352082 CCTCCTTTGAAGAAGACAAATGG + Intronic
957113889 3:76000101-76000123 CAGTCATGGCAGAAGATGAAAGG + Intronic
959389994 3:105761583-105761605 CAATCATGGCAGAAGATAAAAGG - Intronic
960135731 3:114103139-114103161 CAGTCTCTGCAGTAGATAATGGG + Intergenic
960503391 3:118464653-118464675 CACTCATGGCAGAAGATAAAGGG + Intergenic
961500398 3:127328523-127328545 CCCTCTGTGCAGGAGAAAAAGGG - Intergenic
965246200 3:166273059-166273081 ACATCTATGCTGAAGATAAAGGG - Intergenic
965582022 3:170278789-170278811 CAGTCTTGGCAGAAGGCAAAGGG + Intronic
966653451 3:182326963-182326985 CCATCATTTCAGAAGAGAAAGGG - Intergenic
966831850 3:184017153-184017175 CCGTCTGTGCAGAAACCAAATGG + Intronic
967232245 3:187350768-187350790 CCATCTTTGCAGGTAATAAAGGG + Intergenic
969695606 4:8732567-8732589 CAGTCATGGCAGAAGATGAAGGG - Intergenic
970264621 4:14267788-14267810 TGCTCTTTGCAGAAGACAAAGGG - Intergenic
972000586 4:34027554-34027576 CAGTCTTCGCAGAAGGTGAATGG - Intergenic
973725742 4:53773924-53773946 CAGTCCTGGCAGAAGCTAAAGGG + Intronic
974732939 4:65893471-65893493 TCCTCTTTGCAGGAGAGAAAAGG + Intergenic
975960416 4:79897375-79897397 CCGTCTCTGCAGTAGACAATGGG - Intergenic
976698283 4:87941624-87941646 TGGTTTCTGCAGAAGATAAATGG + Intergenic
977583269 4:98747605-98747627 CAGTCTTGGCAACAGATAAAGGG + Intergenic
981776897 4:148378657-148378679 CCATCATAGCAGAAGATAAAGGG - Intronic
982926192 4:161339673-161339695 CAGTCATGGCAGAAGACAAAGGG - Intergenic
986605328 5:9517294-9517316 ATGTCTTTGCAGAAGGAAAAGGG + Intronic
986660274 5:10053151-10053173 CAATCATGGCAGAAGATAAAGGG + Intergenic
986925972 5:12751721-12751743 ATGTCTTTTCAAAAGATAAAAGG - Intergenic
986938440 5:12919647-12919669 TCGGCCTTGCAGAAGATAGATGG - Intergenic
988074908 5:26339728-26339750 CAGTCATGGCAGAAGATGAAGGG + Intergenic
988924649 5:35977587-35977609 CTGTCATAGCAGAAGACAAAGGG - Intronic
990454879 5:55975368-55975390 CAGTCATGGCAGAAGACAAAGGG - Intronic
990948041 5:61270231-61270253 CCCACTTTGCAGATGACAAAAGG - Intergenic
991414221 5:66375813-66375835 TCTTGTTTGCAGAAGATAAAAGG + Intergenic
991549899 5:67824510-67824532 CATTCATTGCAGAAGGTAAAGGG - Intergenic
992612012 5:78516032-78516054 CCTTCTCTTCAGAAGACAAAAGG + Intronic
992975041 5:82107379-82107401 GGGTGTTTGCAGGAGATAAAGGG + Intronic
993100766 5:83537219-83537241 CCATCTGTGCAGTACATAAATGG + Exonic
994019165 5:95003676-95003698 CAGTCATGGCAGAAGGTAAAGGG - Intronic
994438878 5:99775781-99775803 GCTTCATTGCAAAAGATAAATGG + Intergenic
996674533 5:126158671-126158693 CAGTCATGGCAGAAGACAAAGGG - Intergenic
996711130 5:126544593-126544615 AAGTCTTTGCAGTAGATACAGGG - Exonic
998042600 5:138961904-138961926 CTGTGTTTGGAGAAGCTAAAAGG - Intronic
998196441 5:140076897-140076919 CAGACTTTTCAGCAGATAAATGG - Intergenic
998381233 5:141727124-141727146 CAGTCATGGCAGAAGGTAAAGGG + Intergenic
999196076 5:149782635-149782657 CCCTCTTGGCTGAAAATAAAAGG - Intronic
999624879 5:153510063-153510085 CCATCTTGGCAGATGGTAAAAGG - Intronic
999854952 5:155584152-155584174 CTGTCTTTGCACAAGAAAACAGG + Intergenic
1001004718 5:168039953-168039975 CTGTGTTTGCAGAAAACAAATGG - Intronic
1003412653 6:5879268-5879290 CCGTCTCTGCAAAAAATAGATGG - Intergenic
1005616538 6:27578413-27578435 GCACCTTTGCAGAAGAAAAAAGG + Intergenic
1010676892 6:78755778-78755800 CAGTCTTGGCAGAAGGTGAAGGG - Intergenic
1013652423 6:112209227-112209249 CCCTCTCTGCAGAAGAAAACAGG + Intronic
1014397579 6:120945087-120945109 CAATCATTGCAGAAGGTAAAGGG + Intergenic
1017500128 6:155016386-155016408 CCATTTTTGTAGAACATAAAAGG + Intronic
1018412036 6:163559606-163559628 CCTACTTTGCAGAAGATTACAGG - Intronic
1024370957 7:48583193-48583215 ATGTCTTTACAGAAGATAAGGGG - Intronic
1026549147 7:71352242-71352264 CAGTCATGGCAGAAGGTAAAAGG - Intronic
1026793831 7:73353030-73353052 CTGTCTTTGAAGAAGAGGAAGGG - Intronic
1027300249 7:76826981-76827003 CCATCATGGCAGAAGGTAAAAGG + Intergenic
1027729468 7:81851909-81851931 CAGTTTTTGCAGAGGATATAAGG - Intergenic
1029585526 7:101468442-101468464 CCCTATTTCCAGAAGAGAAACGG - Intronic
1031760477 7:125707439-125707461 CAGTCATGGCAGAAGATGAAGGG + Intergenic
1035426338 7:158777577-158777599 CAGTCATGGCAGAAGATGAAGGG - Intronic
1035885002 8:3282006-3282028 CAGTCATGGCAGAAGGTAAAGGG - Intronic
1038474390 8:27854207-27854229 CAGTGTTTGCTGAAGGTAAATGG - Intergenic
1038882083 8:31625927-31625949 CCATCTTTGGAGAAGAGAACAGG + Intergenic
1039197827 8:35052129-35052151 CAGTCATGGCAGAAGATGAAAGG + Intergenic
1040494114 8:47950810-47950832 CCATCTCTGCAAAATATAAAAGG + Intronic
1042025953 8:64423711-64423733 CAGTCATGGCAGAAGACAAAGGG + Intergenic
1043085430 8:75826220-75826242 CTATTTTGGCAGAAGATAAAGGG - Intergenic
1045005443 8:97913231-97913253 CCAGCGTTGCAGAAGCTAAAAGG - Intronic
1046522508 8:115343453-115343475 CCTTTTTTGCAGAAGGAAAATGG - Intergenic
1049409918 8:142468353-142468375 CCGTCTTTCCACAAGACCAACGG - Intronic
1050567850 9:6905245-6905267 CCGTCTTGGCAGGAGATTGAGGG + Intronic
1051020432 9:12535912-12535934 CAATCATGGCAGAAGATAAAAGG + Intergenic
1055366634 9:75550951-75550973 CAGTCATGGCAGAAGGTAAAGGG - Intergenic
1055463833 9:76544519-76544541 CCGTCATGGCAGAAGGCAAAAGG + Intergenic
1185872656 X:3676921-3676943 CAGTCATGGCAGAAGGTAAAAGG - Intronic
1186270281 X:7879252-7879274 CCCTATTTGCAGAAGATACGAGG - Intergenic
1186935719 X:14448783-14448805 CCGTCTTTGCAGATGGACAAGGG + Intergenic
1187255144 X:17635511-17635533 ACGTCTTTGCATAAAAGAAAAGG + Intronic
1189775993 X:44470578-44470600 CAGTCATGGCAGAAGACAAAGGG + Intergenic
1189872127 X:45394931-45394953 CAGTCATGGCAGAAGGTAAAGGG + Intergenic
1190395651 X:49979040-49979062 CCAACTTTGGAGAGGATAAAGGG + Intronic
1190628754 X:52364876-52364898 CAGTCTTTTCAGAAAAAAAATGG + Intergenic
1191093872 X:56654614-56654636 CCAGCTTTGGAGAACATAAATGG - Intergenic
1193166173 X:78283303-78283325 CCGTCTTAGCAGAAAACAAATGG + Intronic
1194452200 X:94058112-94058134 CAGTCTTTGCAAAAAATTAAAGG - Intergenic
1195755234 X:108193092-108193114 CAGTCTTTGGAGAAGGTAAAGGG + Intronic
1197084313 X:122454412-122454434 CGGCCTTTGCAGAAGACAGATGG - Intergenic
1198630272 X:138629576-138629598 CCATCATGGCAGAAGATGAAGGG - Intergenic
1200791272 Y:7301739-7301761 CAGTCATGGCAGAAGGTAAAAGG + Intergenic
1201929965 Y:19332829-19332851 CCCTCATTGCACAAGGTAAAAGG - Intergenic