ID: 1093090311

View in Genome Browser
Species Human (GRCh38)
Location 12:14913093-14913115
Sequence TTGTGAGTATGGGGGAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 349}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093090306_1093090311 -4 Left 1093090306 12:14913074-14913096 CCAAATGATGAGAGTTAGATTGT 0: 1
1: 0
2: 0
3: 8
4: 132
Right 1093090311 12:14913093-14913115 TTGTGAGTATGGGGGAAAGATGG 0: 1
1: 0
2: 1
3: 27
4: 349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093090311 Original CRISPR TTGTGAGTATGGGGGAAAGA TGG Intergenic
900272511 1:1798897-1798919 TTGTGAGTCTGGGTGACATAGGG - Intronic
902717364 1:18281914-18281936 TTGGGGGTGTGGTGGAAAGAGGG + Intronic
904390208 1:30179994-30180016 CTGTGAGGGTGGGGCAAAGACGG + Intergenic
904645931 1:31966305-31966327 CTCTGAGAATGGAGGAAAGAGGG + Intergenic
904906040 1:33897942-33897964 TTGTGAGTGTGGGTGTAAGGTGG + Intronic
905967037 1:42107311-42107333 TGGTGAGTATGTGGGTAAGCTGG - Intergenic
906793986 1:48682103-48682125 ATGTGAGGACAGGGGAAAGATGG + Intronic
907157165 1:52345185-52345207 TTCTTAGTGTGGGGTAAAGAGGG + Intronic
907590753 1:55668598-55668620 TAGTGAGAATGAGGAAAAGAAGG + Intergenic
907627360 1:56043346-56043368 ATGAGAGGGTGGGGGAAAGAGGG - Intergenic
907657080 1:56354990-56355012 TTTTGATGATGGGGTAAAGATGG - Intergenic
907918145 1:58889369-58889391 TTGTGTGTCTGGGGAACAGAGGG - Intergenic
909716297 1:78711033-78711055 TTGTGAGTTTAGGGAAAATATGG + Intergenic
910389496 1:86724081-86724103 TTGTAAGTGTCTGGGAAAGATGG - Intronic
910490227 1:87761140-87761162 CTGTGTGCATGGGGGAAAGCAGG - Intergenic
913970698 1:143413551-143413573 TTTTCATTAAGGGGGAAAGAAGG - Intergenic
914065075 1:144239162-144239184 TTTTCATTAAGGGGGAAAGAAGG - Intergenic
914114076 1:144727192-144727214 TTTTCATTAAGGGGGAAAGAAGG + Intergenic
914439466 1:147691149-147691171 TTCTCATTATGGGGGAAAAAGGG - Intergenic
915088208 1:153403255-153403277 TTGTGTGTATGAAGGAAGGAAGG + Intergenic
915096679 1:153467565-153467587 TTGTGCGTATGAAGGAAGGAAGG - Intergenic
915457524 1:156050819-156050841 CTGTGAGTCTGGGGAAAAGTTGG - Intronic
915944578 1:160140513-160140535 TTGTGTGTGTGGGGGGAGGAGGG + Intronic
916842266 1:168612840-168612862 TTTTGAGTTTGGGGGAACCAGGG + Intergenic
917779002 1:178371313-178371335 GTGTGTGTGTGTGGGAAAGAAGG - Intronic
918273415 1:182925769-182925791 TTTTGACTATTGGGGAAAGTGGG - Intronic
918319169 1:183348535-183348557 TTGGGGGTGTGGGGGAATGATGG + Intronic
918322812 1:183381066-183381088 TTGTGAGAATGAGGGAGAGATGG + Intronic
918571325 1:185996654-185996676 TAGTTAGAATGGGGAAAAGAAGG + Intronic
918625950 1:186656168-186656190 TGGTGAGCATGAGGCAAAGAGGG - Intergenic
919204396 1:194402676-194402698 TGGTGAGGATGTGGAAAAGAGGG + Intergenic
919223916 1:194668765-194668787 TAGTGAGTAGTGGGGAAAAATGG + Intergenic
919434472 1:197539923-197539945 TTGAGAATGTGGGGGAATGAAGG + Intronic
922331419 1:224580213-224580235 TTGGGAGTATGGATGAAAGTGGG - Intronic
922345512 1:224693143-224693165 TTGTTAGTCAGAGGGAAAGAGGG + Intronic
922527684 1:226318338-226318360 TAGTGAGCGTGGGGAAAAGAAGG - Intergenic
922628618 1:227080836-227080858 TTGTGAGTATGTGGCCAAGTTGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924356041 1:243177065-243177087 TGGTGAGGATGGGGGATACAGGG + Intronic
1062840398 10:666102-666124 CTGTGAGTTCGTGGGAAAGAAGG + Intronic
1063001900 10:1932482-1932504 TAGGGAGAGTGGGGGAAAGAGGG + Intergenic
1063495967 10:6508645-6508667 TTGTGAATAAGGAGTAAAGATGG + Intronic
1063823771 10:9869561-9869583 TTGACAGTATGGGGGACAGATGG + Intergenic
1064354113 10:14602990-14603012 GTGTGTGTGTGTGGGAAAGAGGG - Intronic
1065059744 10:21887707-21887729 TTTTGTGTATGGTGTAAAGAAGG - Intronic
1065138349 10:22695416-22695438 TTGTGAGTTTGGGAAAAACAAGG - Intronic
1066101931 10:32125214-32125236 TTGTGAGGAAGGGGGAAGGGCGG - Intergenic
1068665817 10:59674848-59674870 CTGGGAGTGTGGGGGCAAGATGG + Intronic
1071584553 10:86807017-86807039 TTCTGGGGATGGGGCAAAGAAGG - Intronic
1072025618 10:91452987-91453009 ATGTGAGGAAAGGGGAAAGAAGG + Intronic
1072074974 10:91961600-91961622 TTTTGTTTATGGGGGTAAGAGGG - Intronic
1072348209 10:94529796-94529818 GTGTGAGCATGGGGGATAGCAGG + Intronic
1073503521 10:103964564-103964586 CTATGAGTAGGGGGGAAGGAAGG + Intergenic
1074405659 10:113178375-113178397 TTGTGAGAAAGAGGGAGAGAAGG + Intergenic
1074625976 10:115187124-115187146 TGGTGAGGATGTGGAAAAGAGGG + Intronic
1075162275 10:120034710-120034732 GTGGGAGAGTGGGGGAAAGAGGG + Intergenic
1075385986 10:122055820-122055842 TTGTGCGTATGCGGGCAATAGGG + Intronic
1075584715 10:123649223-123649245 AAGTGAGTGTTGGGGAAAGAAGG + Intergenic
1078568384 11:12436693-12436715 TTGGGAGGATGGGGGCAGGAAGG + Intronic
1080380888 11:31771377-31771399 TTGTAAGGATGTGGGTAAGATGG + Intronic
1080489996 11:32751846-32751868 TTTTGAGGGTGGGGGCAAGATGG - Intronic
1081192741 11:40124175-40124197 TGGTGAGGATGTGGGAAAAAGGG + Intronic
1083380263 11:62261766-62261788 TTTGGAGTAGGGGAGAAAGAAGG - Intergenic
1085296749 11:75435701-75435723 TCGTGAGGATGGGTGACAGATGG + Intronic
1085353153 11:75813963-75813985 TTGTGTGTGTGTGGGAAGGAGGG + Intergenic
1085615295 11:77993472-77993494 ATGTGAGGATGGGTGGAAGAGGG + Intronic
1086762969 11:90656676-90656698 AGGTGAGTATGGAGGAAATAAGG - Intergenic
1086929259 11:92674441-92674463 GAGTGAGTAGGGGGAAAAGAGGG - Intronic
1088337561 11:108723590-108723612 GTTTAAGTATGGGGGAAAGGAGG - Intronic
1089056650 11:115591061-115591083 TAGTGAGTGTGGGAGACAGATGG + Intergenic
1090037213 11:123259451-123259473 TTGTGGGTTTAGGGGAATGAGGG + Intergenic
1090167449 11:124565148-124565170 TTGTGGGTTTGCGGGAATGAGGG - Intergenic
1090722065 11:129484830-129484852 TGGTGAGGATGGGGAAAAAAGGG - Intergenic
1090992290 11:131829004-131829026 TTGTGTGTATGTGAGAGAGAGGG - Intronic
1091155460 11:133367762-133367784 TTGTGAGTGTGGTGGAAGAAGGG - Intronic
1092140239 12:6178794-6178816 TTGTGAGAGTGGGGGAAAAAAGG - Intergenic
1093073528 12:14732733-14732755 TTGAGAGGATGGAGGAAAGGAGG + Intergenic
1093090311 12:14913093-14913115 TTGTGAGTATGGGGGAAAGATGG + Intergenic
1093709536 12:22314205-22314227 TAGTGAGCATGGAGGAAGGAGGG - Intronic
1095353998 12:41249503-41249525 TTGTGAGGATTTGGGGAAGAAGG + Intronic
1097201893 12:57286118-57286140 TTGTGTGTATGTTGGAGAGATGG + Intronic
1098051966 12:66463717-66463739 TGGTGAGTCAAGGGGAAAGATGG + Intronic
1098286132 12:68908699-68908721 TTATGACCTTGGGGGAAAGAGGG + Intronic
1098484110 12:71000874-71000896 GTGTGTGTATGGGGGATAGCGGG - Intergenic
1100322247 12:93506707-93506729 TTTTGACTAGAGGGGAAAGAAGG - Exonic
1100472488 12:94905835-94905857 TTGTGGGTTTAGGGGAATGAAGG + Intronic
1101709997 12:107256413-107256435 TTGTGGGAATGGGGAAAACAGGG + Intergenic
1101891044 12:108715641-108715663 TTGTGAGTATGCGGGGGGGAGGG - Intronic
1102640014 12:114358888-114358910 TTATGAATCTGGGGGAAGGAAGG - Intronic
1103323022 12:120102641-120102663 CTGGGAGTATGGGGGAGAGCAGG - Intronic
1103408510 12:120693442-120693464 TTGTGAGTCTGTGGGAAGGAAGG + Intronic
1105672920 13:22640814-22640836 CTGTGACTATTGAGGAAAGACGG - Intergenic
1106295427 13:28409231-28409253 TTTTGAGTGTGGTGGGAAGAGGG - Intronic
1106356228 13:28986161-28986183 TTGGGAGGATGGGGGCAGGAAGG + Intronic
1106884270 13:34166658-34166680 CTGTGGGTATGTGGAAAAGAAGG + Intergenic
1106963154 13:35025336-35025358 TTTTGTGTATGGTGAAAAGAAGG + Intronic
1109029481 13:57174766-57174788 GTATGATTCTGGGGGAAAGATGG + Intergenic
1109609446 13:64744141-64744163 TTGTGAAGATGGGGGACAGAGGG - Intergenic
1110027872 13:70565045-70565067 TTGTGGGTTTACGGGAAAGAAGG + Intergenic
1110525418 13:76531283-76531305 TTCTGAGTTTAGGGGATAGAGGG + Intergenic
1110760854 13:79228868-79228890 CTGTGACAAAGGGGGAAAGATGG - Intergenic
1110998757 13:82149984-82150006 TTCTGAGGACTGGGGAAAGAGGG - Intergenic
1111017552 13:82401211-82401233 TTTTGAGTATGGTGAAAAGTAGG - Intergenic
1111083703 13:83344942-83344964 TGGAGAGGATGGGGGAAAGTGGG + Intergenic
1111930993 13:94513136-94513158 TTGTGATGCTGGGTGAAAGAAGG + Intergenic
1112161847 13:96876478-96876500 TTGTGAGAATGGGAGATTGAGGG + Intergenic
1112369444 13:98782098-98782120 TTGAGTGTATGTGGGACAGAAGG - Intergenic
1113233091 13:108237340-108237362 TTATGAGTGTGGAGGAATGAGGG + Intergenic
1113683020 13:112257415-112257437 TGGTGAGGCTGGGGGCAAGAGGG - Intergenic
1115959462 14:38819355-38819377 TTGTGAGTTTACGGGAATGAGGG + Intergenic
1116055413 14:39858092-39858114 TTGTGACTTTGGGGGAAAACAGG - Intergenic
1118615331 14:67571316-67571338 GTGAGAGTATGGGGAGAAGATGG - Intronic
1120249196 14:82041686-82041708 TTGGGAGTAAGGGAGAATGAAGG - Intergenic
1121023809 14:90599571-90599593 GTGTGAACATGGGGGAACGATGG + Intronic
1122832839 14:104410021-104410043 TTGTGTTTTTGGGAGAAAGAGGG - Intergenic
1125309606 15:38364371-38364393 TTTTGTGTATGGTGCAAAGAAGG + Intergenic
1128001331 15:64195329-64195351 TTGTGGGTATGTGAAAAAGAAGG - Intronic
1128331147 15:66756612-66756634 TTGTGGGTATGTGGGATGGAGGG - Intronic
1128394870 15:67214467-67214489 GTGTGGGTAGGTGGGAAAGAGGG + Intronic
1128523352 15:68390207-68390229 TTGTGAGTGAGGTGGGAAGAAGG + Intronic
1128670541 15:69571674-69571696 TTGTGAGTAGTGGTGACAGAGGG + Intergenic
1128823735 15:70688833-70688855 TTGGGAGTATGTGGGAAGTAGGG + Intronic
1129044666 15:72723835-72723857 TTCTGAGTCAGGGGAAAAGAAGG + Intronic
1130921306 15:88347362-88347384 TTGTGAGTCTGGAGGGAACAAGG + Intergenic
1131606239 15:93905951-93905973 TTGAGAGTTTGTGTGAAAGATGG - Intergenic
1131707136 15:95009490-95009512 TTCTGAGTATAGAGGTAAGAAGG - Intergenic
1131744122 15:95427363-95427385 GTGTGTATATGGGGGATAGATGG - Intergenic
1132066760 15:98737642-98737664 TTGTGGGGACGGGGCAAAGAGGG - Intronic
1132255318 15:100372067-100372089 TTGTGAGGCTGCGGGGAAGAGGG - Intergenic
1133496217 16:6320355-6320377 TTGTAAGTATTGGGTAGAGAGGG + Intronic
1133560390 16:6945150-6945172 ATGAGAGTATGGGGAAAAAAGGG + Intronic
1139325568 16:66150259-66150281 TTGTTAGAATGGGGAAGAGAAGG - Intergenic
1139606940 16:68025695-68025717 CTGTGAGTGAGGGGGAAAAAAGG - Intronic
1140187033 16:72783642-72783664 TTGGAAGGATGGAGGAAAGATGG + Exonic
1140442377 16:74998177-74998199 ATGTGAATATAGGAGAAAGACGG + Intronic
1141197827 16:81874578-81874600 TTGTGATTTGGGGGGAATGAGGG + Intronic
1141300479 16:82810867-82810889 TTGTGAGTCAGGGGGAAATGGGG + Intronic
1143642055 17:8204807-8204829 GTGTATGTATAGGGGAAAGAAGG - Exonic
1144032660 17:11336325-11336347 ATGTGGGTATGGGGTAAAGGAGG + Intronic
1146101351 17:29985756-29985778 TTGTGAGTTTACCGGAAAGAGGG - Intronic
1147369165 17:39980028-39980050 TTGGGAGTGTTGAGGAAAGAGGG - Intergenic
1148554345 17:48569342-48569364 ATGTGAGTGTGGGAGACAGACGG - Intronic
1148958680 17:51374889-51374911 TGGGGAGTAGGGGGGAAAGAGGG + Intergenic
1149545455 17:57500274-57500296 ATGTGAGAAAAGGGGAAAGAAGG + Intronic
1154335438 18:13461284-13461306 TTGAGAGTCTGGGGGAACCAGGG + Intronic
1155333961 18:24746156-24746178 AAGTGAGTATGTGAGAAAGAGGG - Intergenic
1156107333 18:33679650-33679672 TTGTGTGTATGTGGGAAAGAGGG + Intronic
1156604844 18:38654245-38654267 TTGTGAGGATTGGGGGATGATGG + Intergenic
1156934747 18:42690077-42690099 TTTTGTGTTTGGGGGAAAAAAGG + Intergenic
1157302839 18:46491908-46491930 TTGAGAGGACGGGGGAAAGGGGG - Intronic
1158072426 18:53488765-53488787 TTGTGTGTATGTGGGATAGGAGG + Intronic
1162156387 19:8680934-8680956 GAGTGAGTAAGGGGGAGAGAGGG + Intergenic
1164230659 19:23284870-23284892 ATGTCAGTGTGGAGGAAAGAAGG + Intergenic
1164948110 19:32313080-32313102 TTGTGAGTTTGAGGATAAGACGG + Intergenic
1166226034 19:41396047-41396069 TGGGGAGTATGGGGGAAAACAGG - Intronic
1166512127 19:43415982-43416004 CTGTGCGTATGGGGGACATAGGG + Exonic
1167108549 19:47445691-47445713 TTGTGGGGGTGGGGGACAGAGGG + Intronic
1167490419 19:49789825-49789847 TTGTGACTGTGGGGCACAGATGG - Intronic
1168072079 19:53958984-53959006 CTGAGAGGATGGGGGAGAGAGGG - Intergenic
925281833 2:2690419-2690441 GTGTGAGTAGGGAGGAGAGAGGG - Intergenic
925376575 2:3389933-3389955 TTGTGAGTATGCAAAAAAGAAGG + Intronic
925474699 2:4200073-4200095 TTTTGGGTATGGAGGAAAGTGGG + Intergenic
925744039 2:7029797-7029819 TTCTGAGCTTGTGGGAAAGAAGG - Intronic
927237124 2:20884621-20884643 TTTTGAGGATGGTGCAAAGATGG - Intergenic
927264775 2:21133184-21133206 TTCTGAATATGTGGAAAAGATGG + Intronic
927770610 2:25857806-25857828 TTGTAGGTAGGGGTGAAAGATGG - Intronic
929042051 2:37754074-37754096 TGGTGAGCATCGGGGAAGGATGG - Intergenic
929545667 2:42854108-42854130 GTGTGAGTATGGGAGATGGATGG + Intergenic
930732327 2:54739951-54739973 TTGGGAGTAGGGTAGAAAGAAGG + Intronic
931132316 2:59350398-59350420 TTCTGTGTATGGTGTAAAGAAGG - Intergenic
931208341 2:60169039-60169061 TTGAACGTATGGGGGAAAGAAGG + Intergenic
931208378 2:60169341-60169363 TTGAATGTATGGAGGAAAGAAGG - Intergenic
931251867 2:60538777-60538799 GTGTGTGTAATGGGGAAAGAGGG + Intronic
931369153 2:61646059-61646081 TGGTGAGGATGTGGAAAAGATGG + Intergenic
931497739 2:62828654-62828676 TTTTGAGTTTGTGGGTAAGAGGG - Intronic
931838982 2:66128925-66128947 TTTTGACTCTGGGAGAAAGAGGG + Intergenic
931925651 2:67069436-67069458 TTTTGTGTATGGTGTAAAGAAGG - Intergenic
933189146 2:79313818-79313840 GTGTGTGTTTGGGGGTAAGAGGG + Intronic
933246232 2:79977931-79977953 TGGTGAGTACAGTGGAAAGAAGG + Intronic
934175394 2:89574477-89574499 TTTTCATTAAGGGGGAAAGAAGG - Intergenic
934285710 2:91648840-91648862 TTTTCATTAAGGGGGAAAGAAGG - Intergenic
934901297 2:98162026-98162048 ATGTTACTATGGGGGAAAGTGGG - Intronic
935481817 2:103599047-103599069 TTTTGTGTATGGTGAAAAGAAGG - Intergenic
936627480 2:114163848-114163870 CTGTGACTATGGGGGAGAGAAGG + Intergenic
937506627 2:122544838-122544860 TTGTGTGAGTTGGGGAAAGAAGG + Intergenic
937588448 2:123585301-123585323 TATTGAATATTGGGGAAAGATGG + Intergenic
938852662 2:135277148-135277170 TGGGAAGTATAGGGGAAAGAAGG - Intronic
940438997 2:153691943-153691965 TTGTGTGAATTGGGTAAAGATGG + Intergenic
941024239 2:160440555-160440577 TGGTGAGGGTGGGGGAGAGATGG - Intronic
941239093 2:163014805-163014827 TTGTGGGTTTAGGGGAATGAGGG + Intergenic
941258108 2:163259196-163259218 TTGTGGGTTTAGGGGAAGGAGGG - Intergenic
942046996 2:172105438-172105460 TTGTGTACATGGGGGAAAGAGGG + Intergenic
942364959 2:175215757-175215779 TTGTGGGTTTGGGGGAGAGGCGG - Intergenic
942774019 2:179558949-179558971 CTGTGAGTATGGGGTAAAATTGG + Intronic
943435193 2:187856881-187856903 CTGTGACTTTGGGAGAAAGAAGG + Intergenic
945135933 2:206627478-206627500 CTGGGAGTATCAGGGAAAGACGG + Intergenic
947466330 2:230350732-230350754 TTGGGAGTATGGGGGCAGGATGG + Intronic
947546217 2:231012086-231012108 TTGGGAGTCTGGAGGAAAGGAGG + Intronic
948754696 2:240152014-240152036 TAGGGAGGATGGGGGAAACACGG + Intergenic
948770449 2:240248953-240248975 AGGTGAGTATGGGGGGCAGAGGG + Intergenic
1170857867 20:20074092-20074114 TTGTGAGTAAGGAGGACAGAAGG + Intronic
1172441800 20:34971363-34971385 TTGTGAAGATGGGGGACAGCTGG + Intergenic
1172501794 20:35432936-35432958 CTGTGAGTATGGGGGTAGCAGGG + Intergenic
1173313589 20:41923053-41923075 TTGTGATTCTGAGTGAAAGAGGG + Intergenic
1173474087 20:43346306-43346328 TTCTCAGGATGGGTGAAAGAAGG - Intergenic
1174941720 20:54936577-54936599 TTGTGATTTGGGGGGAAAAAAGG - Intergenic
1175485672 20:59344254-59344276 TTGTGAGTCTGGGGGTAAGCAGG - Intergenic
1178064343 21:28887449-28887471 TTGTGAATATGGTGGAAAAAAGG - Intergenic
1179206492 21:39285314-39285336 TGGGGAGTATGGGGGAAGGGGGG + Intronic
1179330838 21:40399359-40399381 TTGAGAGTATGGGTGGAAAAGGG + Intronic
1179381687 21:40905285-40905307 ATGTGTGTAAGGGGAAAAGAAGG + Intergenic
1182041597 22:27242449-27242471 TATTGAGTATGCTGGAAAGAAGG + Intergenic
1182114157 22:27745410-27745432 TTGACAGTCTGGGGGAACGAGGG - Intergenic
1182139063 22:27936850-27936872 TTCTCAGTGTTGGGGAAAGAAGG - Intergenic
1183617458 22:38954329-38954351 GTGGGGGTATGGGGGACAGAGGG + Intronic
1183724835 22:39582754-39582776 GTGGGTGTATGGGGGAAAGATGG - Intronic
1183724845 22:39582781-39582803 GTGAGTGTATGGGGGAAAGATGG - Intronic
1183815266 22:40294717-40294739 ATTTGAGTCTGGGGGAAAGGAGG - Intronic
1184707392 22:46224058-46224080 TTGTGGGTGTGGGTGGAAGAGGG - Intronic
949243484 3:1898016-1898038 TAGTGAGAATGTAGGAAAGAGGG + Intergenic
950224621 3:11223600-11223622 TGGGGAGTGTGGGGCAAAGAGGG + Intronic
951875315 3:27418348-27418370 AGGTAAGTATGGGGGTAAGAAGG + Intronic
952131662 3:30371059-30371081 TTGGGAGAATGCAGGAAAGAGGG - Intergenic
954150517 3:48654925-48654947 TTGGTGGTTTGGGGGAAAGATGG + Intronic
955480924 3:59389133-59389155 TTGTGAGCGTGGGAGAGAGAGGG + Intergenic
956766929 3:72491959-72491981 CTGGGAGGATGGTGGAAAGAAGG + Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957534536 3:81484615-81484637 TTGCGAGTAGGAGGGGAAGAGGG + Intergenic
957606985 3:82413092-82413114 TTGTGAGTGTGGGTGAGAGAGGG - Intergenic
960172556 3:114479091-114479113 TTTTCAGGATGGGGGGAAGAAGG + Intronic
961087999 3:124085611-124085633 TTATGAGTAGGGGGTAGAGAAGG + Intronic
962637409 3:137345398-137345420 TTGTGAGGCTATGGGAAAGAAGG + Intergenic
965074354 3:163957562-163957584 TTGTGAGTAAGTGGGGAAGCAGG - Intergenic
965122617 3:164581627-164581649 TTTTGATTTTGGGGGGAAGATGG - Intergenic
965899275 3:173618666-173618688 TTTTGAGTATGGTGGAAAATGGG + Intronic
966464083 3:180210326-180210348 TGGTGAGGATGTGGGAAAAAAGG + Intergenic
969127400 4:4962138-4962160 TTTAGAGTATAGGGGAAAAAAGG - Intergenic
969219791 4:5752190-5752212 ATGAGAGTAAGGGGGAAAGGAGG - Intronic
971425198 4:26508947-26508969 TTTTTAATATGGTGGAAAGACGG - Intergenic
971607562 4:28677410-28677432 TTGTGTGTATGGGGGTAATGAGG + Intergenic
971823039 4:31584713-31584735 TTGTCAATATGGGAGACAGAAGG - Intergenic
971902718 4:32682687-32682709 TTGTGAGGTTAGAGGAAAGATGG - Intergenic
972610753 4:40653398-40653420 TTATGACTGTGGGAGAAAGAAGG + Intergenic
973112409 4:46412299-46412321 TTGGAAGCATGGGGAAAAGAGGG + Intronic
973705259 4:53574505-53574527 TTCTGAGTTTGGGAGAAAGATGG - Intronic
974791353 4:66694114-66694136 TTGTTTGTGTGGGGGAAGGAGGG - Intergenic
974940239 4:68459206-68459228 TTGTGAGTAATGTGGAAAGGTGG + Intronic
975036148 4:69685527-69685549 TTTTGTATATGGTGGAAAGAAGG + Intergenic
975811211 4:78171792-78171814 ATGTGAGGAGGGAGGAAAGAAGG - Intronic
976179592 4:82386604-82386626 TTGTGGGTTTAGGGGAATGAGGG - Intergenic
976525330 4:86081213-86081235 TTTTGTGTATGTGTGAAAGAAGG - Intronic
976778491 4:88732465-88732487 TTGTCAGGTTGGGGGTAAGAAGG + Intronic
977740105 4:100469600-100469622 TTTTGAATATGGTGTAAAGAAGG + Intronic
977859421 4:101938306-101938328 TAGTGAGGATGGGGGAAAGTGGG + Intronic
978003423 4:103585417-103585439 TTTTGAGTAGAGGGGCAAGATGG + Intergenic
978511558 4:109525387-109525409 TTGTGAGTATAGTGGAATGATGG - Exonic
979868510 4:125786359-125786381 ATGTGAGGTTGGGGGAAAGAAGG - Intergenic
979930782 4:126627786-126627808 TTGGCAGGATGGGGGAAAGTAGG - Intergenic
980959438 4:139460143-139460165 TTGTGAGTCTGGGTGACAGGAGG + Intronic
983103970 4:163662443-163662465 TTGGAAGTTTGGGGGAAAAAAGG - Intronic
984580989 4:181509831-181509853 TTGTGATTGTAGGGGAAGGATGG - Intergenic
984837748 4:184038272-184038294 CTGTGTGTATACGGGAAAGATGG - Intergenic
984964011 4:185125693-185125715 TTGTGGGTTTAGGGGAATGAGGG + Intergenic
987331399 5:16860636-16860658 TTGAGAGGATGGGAGAAGGAAGG + Intronic
987747701 5:21997702-21997724 TTTTGACTATGAGAGAAAGAAGG - Intronic
987962352 5:24826715-24826737 TTTTGAGTTTGGGGGAGAAAAGG + Intergenic
988990939 5:36670251-36670273 TTCTGAAAATGAGGGAAAGAGGG + Intronic
989651250 5:43692947-43692969 CTTTGAGTATGTGAGAAAGAAGG - Intronic
990017783 5:51086648-51086670 TAGTGAGTATGTGGAAAAAAAGG - Intergenic
990771451 5:59250998-59251020 TTGTGTGTATGGTGAAAGGAAGG - Intronic
991040224 5:62167621-62167643 TAGAGAGTATGGGGGAAGAATGG - Intergenic
991329909 5:65482837-65482859 TTGTGTGTAGGGGGGAGGGAGGG - Intergenic
991570466 5:68048350-68048372 TTGTGAGTTTACGGGAATGAGGG - Intergenic
991767879 5:70007495-70007517 TTTTGAGTATGAGAGAAAGAAGG - Intergenic
991847113 5:70882573-70882595 TTTTGAGTATGAGAGAAAGAAGG - Intergenic
993683971 5:90915579-90915601 TTGTGAGATTGGTGGAAAGAGGG + Intronic
994609132 5:102014006-102014028 TAGGGAGTGTGGGGGAAAAATGG - Intergenic
995341363 5:111064574-111064596 TTGGGGGTTTGGGGGAAAGCAGG + Intergenic
996164293 5:120206088-120206110 TGGGGATTATGGGGGAGAGAAGG - Intergenic
996534680 5:124565204-124565226 TAATGTGTATGGGGGAATGAAGG - Intergenic
1000205692 5:159056369-159056391 TTCAGAGTATGGGGCAAAGGAGG - Intronic
1000478810 5:161745204-161745226 TTGTGGGTATGGGGGATAATGGG + Intergenic
1001494029 5:172175373-172175395 AGGTGAGTATGGTGGAGAGAGGG + Intronic
1001550575 5:172599380-172599402 TGGTGAGGAAGTGGGAAAGATGG + Intergenic
1001571772 5:172735053-172735075 TTGTGTGTATGGGGGCCAGTTGG + Intergenic
1001666698 5:173439099-173439121 GTGTGAGTTTGGGGTAAACAGGG - Intergenic
1001995504 5:176154228-176154250 GCGTGAGGATGGGGCAAAGATGG - Intergenic
1003139590 6:3458852-3458874 TTGTGACTGTGGGGGAAGGGAGG - Intergenic
1003255701 6:4472987-4473009 GTTGGAGGATGGGGGAAAGAGGG - Intergenic
1003615815 6:7654475-7654497 TGGTGATTATGGGGGGAAAAAGG + Intergenic
1004771291 6:18785545-18785567 ATGTAGGTATGGGGGATAGATGG - Intergenic
1005516162 6:26556345-26556367 TGGTGAGAATGGGGAAAAGAGGG + Intergenic
1005797434 6:29380342-29380364 GAGTGAGAAAGGGGGAAAGAGGG + Intronic
1006428615 6:33981727-33981749 GTGTGAGTCTTTGGGAAAGATGG - Intergenic
1007496478 6:42263287-42263309 GGGTGAGTGTGGGGGAGAGAGGG + Intronic
1008485726 6:52033341-52033363 TTGTGGGTGTGGGGGCAGGATGG - Intronic
1008683222 6:53896419-53896441 GTGTGTGTATGGGGGAAGGGAGG + Intronic
1010365935 6:75050998-75051020 TTGAGGTAATGGGGGAAAGATGG + Intergenic
1010863126 6:80938049-80938071 TTGTGAGAAAAGGGGAAAAAGGG - Intergenic
1012123858 6:95401367-95401389 ATTTGAGTTTGGGGGAGAGAGGG - Intergenic
1012188394 6:96250247-96250269 TTGTCAGTATGTCAGAAAGAAGG + Intergenic
1012706138 6:102534225-102534247 TGGTGAGAATGTGGGAAAAAGGG + Intergenic
1013171968 6:107644646-107644668 TGGTAAGAATGGGGAAAAGAAGG + Intronic
1013475726 6:110505675-110505697 TTGTGGGTTTGTGGGAATGACGG + Intergenic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1013841745 6:114404342-114404364 TTATGAGTATGGTGAGAAGAAGG + Intergenic
1013947667 6:115741371-115741393 TTGTGTGTATTGGGTTAAGAAGG - Intergenic
1014289556 6:119542087-119542109 TTGTGTGTTTTAGGGAAAGATGG - Intergenic
1015612664 6:135042342-135042364 TTCAGAGATTGGGGGAAAGAAGG - Intronic
1017248581 6:152255395-152255417 GTGTAAGTATGAGGGAAAAATGG - Intronic
1019048084 6:169163255-169163277 TTGTGAGTCATGGGGAAAAATGG + Intergenic
1019158938 6:170056885-170056907 CTGTAGGTGTGGGGGAAAGATGG - Intergenic
1020347295 7:7179799-7179821 TTGTTATTATGGGTGAAATATGG + Intronic
1020827903 7:13054704-13054726 ATGTGAGCATTTGGGAAAGAAGG - Intergenic
1020865461 7:13555797-13555819 TTATGAGAAAGGGGGAAAAAAGG + Intergenic
1021863702 7:24932964-24932986 ATTTGAATATGGAGGAAAGACGG - Intronic
1021892982 7:25205253-25205275 TAGAGCCTATGGGGGAAAGAGGG + Intergenic
1022787656 7:33654599-33654621 TTGGTAGGATGGTGGAAAGATGG + Intergenic
1023392718 7:39725686-39725708 TTGAGAGTTTGGGAGAAATAGGG + Intergenic
1023863173 7:44227305-44227327 AGGAGAGTATGGGGGACAGAGGG + Intronic
1024405108 7:48970016-48970038 TTCTGAGTATGGAGTATAGAGGG - Intergenic
1024823494 7:53362036-53362058 TGGTGAGAAAGGGAGAAAGATGG - Intergenic
1026392565 7:69916693-69916715 ATGTAAGAATGGGGGGAAGAGGG - Intronic
1028096221 7:86764228-86764250 GTGGGAGGATGGGGGAAGGAAGG + Intronic
1032155808 7:129466795-129466817 CTTGGAGTATGGGGGAAAGGGGG - Intronic
1035825887 8:2643813-2643835 TTGTGTGTGGGGGGGAGAGAAGG + Intergenic
1036279164 8:7384683-7384705 TTTTGGGTGTGGGAGAAAGATGG + Intronic
1036342352 8:7927190-7927212 TTTTGGGTGTGGGAGAAAGATGG - Intronic
1036918860 8:12832527-12832549 TTTTGGGTTTGGGGTAAAGAGGG + Intergenic
1037018444 8:13937753-13937775 TTGTGACTATGAGGAAAATAAGG - Intergenic
1038377204 8:27053140-27053162 TGGTGAGAATGTGGAAAAGACGG + Intergenic
1038452801 8:27650730-27650752 TTGTTGGCATGGAGGAAAGAGGG - Intronic
1038539119 8:28376647-28376669 TAGTGGGTTTGGGGGAAAGTTGG - Intronic
1038646541 8:29366489-29366511 TTGTGAAACTGGGGGCAAGAGGG - Intergenic
1039195835 8:35030566-35030588 TCTTGAGTATCGGGGAAACAGGG + Intergenic
1039625976 8:39053690-39053712 GTGGGAGTTTGGGGGTAAGAAGG + Intronic
1040057714 8:43074892-43074914 TTGTGGGTATGTGGGACAGGTGG - Intronic
1040626899 8:49159757-49159779 TTGTGGGAAAGAGGGAAAGAGGG + Intergenic
1043277558 8:78418973-78418995 GAGAGAATATGGGGGAAAGATGG + Intergenic
1043491071 8:80749687-80749709 GTGTGAGTAAAGGGGAAAAAAGG - Intronic
1043567200 8:81561624-81561646 CTGTGTGCATGGGGGAAGGAGGG + Intergenic
1044975351 8:97659273-97659295 TTATGCATATGGGGGAAGGAAGG - Intronic
1046119890 8:109832508-109832530 TTCTGTGTATGGTGTAAAGAAGG - Intergenic
1046530772 8:115442595-115442617 GTGTGTGTTTGGGGGAAGGAAGG + Intronic
1046619207 8:116510150-116510172 GTGTGTGTATGTGGGAGAGAGGG - Intergenic
1047563413 8:126013595-126013617 TTGTGGGTTTGTGGGAATGAGGG + Intergenic
1047599472 8:126411733-126411755 GTGTGTGTATGGGGGATAGAGGG + Intergenic
1048277094 8:133074825-133074847 TTGGGAGTATGTGGCAGAGATGG - Intronic
1049359808 8:142207109-142207131 ATGGGTGAATGGGGGAAAGATGG + Intergenic
1049435123 8:142583035-142583057 GTGTGAGGCTGGGGGACAGAAGG + Intergenic
1050493478 9:6214653-6214675 TTGTGAGTAATGAAGAAAGATGG - Intergenic
1050863074 9:10461245-10461267 TGGTAAGAATGGGGGAAAAAAGG + Intronic
1053008283 9:34618828-34618850 TTGAGAGTCTGGGAGAATGAGGG - Intronic
1053226347 9:36361474-36361496 TTCTTAGTATGGGGAAAAAATGG - Intronic
1053307658 9:36995548-36995570 CTGTGAGAATGGAGGAAAGGAGG + Intronic
1054902375 9:70382990-70383012 TGGTGAGGATGGAGGAAAGGGGG - Intergenic
1054959139 9:70947741-70947763 GTGTGTGGGTGGGGGAAAGAAGG + Intronic
1055206162 9:73733091-73733113 TTGTGAGTTTGGAGAAAAGGTGG - Intergenic
1057284086 9:93734667-93734689 TTTTGTGTATGGTGTAAAGAAGG - Intergenic
1057730412 9:97603387-97603409 GTGTGAGTATGAAGGAGAGAGGG - Intronic
1057927828 9:99168631-99168653 TTGTGTGTATGAGAGAGAGAAGG - Intergenic
1186167244 X:6839895-6839917 TTGTGTGTATGGGGGAGGGGGGG - Intergenic
1186254889 X:7707772-7707794 TTGTAGGTGTGGGGAAAAGAAGG - Intergenic
1188787246 X:34362523-34362545 TTGTGCCTAAGGGGGAAACAAGG + Intergenic
1188820158 X:34765369-34765391 CTGAGAGGATGGGAGAAAGAGGG - Intergenic
1188894125 X:35645552-35645574 TTGTGGGTTTAGGGGAATGAGGG - Intergenic
1190431737 X:50384575-50384597 GTGTGAGTTTCTGGGAAAGACGG + Intronic
1192037956 X:67586254-67586276 TTGTGTGTTTGGGGGAAGGAGGG - Intronic
1192069517 X:67922484-67922506 TGCTGAGAATGGGGGAGAGATGG - Intergenic
1192782168 X:74305235-74305257 ATGTGTATGTGGGGGAAAGAGGG + Intergenic
1193609333 X:83610138-83610160 TTGTGTGTAAGGAGTAAAGAAGG + Intergenic
1193985593 X:88237378-88237400 TTGTTAGTCTGAGGGAAACAAGG + Intergenic
1194900270 X:99500864-99500886 TTTTGAATATGGTGTAAAGAAGG - Intergenic
1195828916 X:109033567-109033589 TTGTGGGTATGGGGGATGGGTGG + Intergenic
1197026093 X:121751454-121751476 TGATGAGTAAGAGGGAAAGAGGG + Intergenic
1197270298 X:124417871-124417893 TATTGAGTGTGGGAGAAAGAGGG - Intronic
1198439867 X:136652641-136652663 CTGTCATTTTGGGGGAAAGATGG + Intronic
1200770513 Y:7120671-7120693 TGGTGACTTTGGGGGAAAGGAGG - Intergenic