ID: 1093090364

View in Genome Browser
Species Human (GRCh38)
Location 12:14913449-14913471
Sequence ACACTGGGGCTTTCACAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 199}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093090356_1093090364 17 Left 1093090356 12:14913409-14913431 CCACAGAATACCTTGGTCTCGTT 0: 1
1: 0
2: 0
3: 5
4: 90
Right 1093090364 12:14913449-14913471 ACACTGGGGCTTTCACAGTGTGG 0: 1
1: 0
2: 2
3: 28
4: 199
1093090355_1093090364 20 Left 1093090355 12:14913406-14913428 CCTCCACAGAATACCTTGGTCTC 0: 1
1: 0
2: 0
3: 8
4: 91
Right 1093090364 12:14913449-14913471 ACACTGGGGCTTTCACAGTGTGG 0: 1
1: 0
2: 2
3: 28
4: 199
1093090359_1093090364 7 Left 1093090359 12:14913419-14913441 CCTTGGTCTCGTTGCTGAAGGGC 0: 1
1: 0
2: 0
3: 8
4: 80
Right 1093090364 12:14913449-14913471 ACACTGGGGCTTTCACAGTGTGG 0: 1
1: 0
2: 2
3: 28
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093090364 Original CRISPR ACACTGGGGCTTTCACAGTG TGG Intergenic
902542284 1:17163688-17163710 CCAGTGGGGCTTTCACATGGGGG + Intergenic
902726191 1:18337772-18337794 TCAGAGGGGCTTTCACATTGAGG + Intronic
902995473 1:20221629-20221651 GCTCTGGGGCTTTCTCTGTGTGG - Intergenic
903295350 1:22339879-22339901 ACACTGTGGTGCTCACAGTGTGG - Intergenic
903550623 1:24155493-24155515 ACACTGTGGCTTTCCACGTGAGG - Exonic
905092979 1:35444481-35444503 ACACTGGGGCTTTGTAAGAGGGG + Intronic
908194020 1:61731038-61731060 ACACTGGGGCTGTCAGGGGGTGG + Intergenic
910973058 1:92876113-92876135 ACACTGGAATTTTCAAAGTGGGG + Intronic
915492327 1:156257966-156257988 ACAATCTGGTTTTCACAGTGGGG - Intronic
916304722 1:163317458-163317480 ATACTGGGGCATTGCCAGTGTGG - Intronic
919692338 1:200539234-200539256 ACACTGATGCATTCACAGAGTGG + Intergenic
920214712 1:204353891-204353913 AAACTGGGGCTGTCTCACTGGGG - Intronic
922097455 1:222454563-222454585 CCACTGGAGCTTTCACGGTGGGG + Intergenic
922699623 1:227751144-227751166 ACACTGTGGCTTTGATTGTGCGG + Intronic
922761505 1:228134842-228134864 ACACGGGGCCTTTTACATTGTGG + Intergenic
923251270 1:232181371-232181393 ACACTGTGGCCTACAAAGTGTGG + Intergenic
1064293250 10:14054335-14054357 GCACTGTGACTTTCCCAGTGTGG + Intronic
1067531725 10:47079048-47079070 ACACTGGGCCTCTGCCAGTGGGG + Intergenic
1069149791 10:64945369-64945391 ACACTGGGACTATCAGAATGGGG + Intergenic
1069981296 10:72254766-72254788 ACACAGGGGCTTTTGCAGAGAGG + Intergenic
1070178143 10:73990014-73990036 TAACTGTGGCTTTCAAAGTGTGG + Intergenic
1070262787 10:74873592-74873614 AGACTGGGGTTTTGACAGTGGGG + Intronic
1071756154 10:88542503-88542525 ACACTGGTGACCTCACAGTGAGG + Intronic
1074052777 10:109895163-109895185 ACAATGGGGAATACACAGTGAGG + Intronic
1075413734 10:122247732-122247754 ACGCTGGGGAGTTCACAGTGGGG + Intronic
1075511239 10:123074381-123074403 AGCTTGGGGCTGTCACAGTGAGG + Intergenic
1076889739 10:133277620-133277642 TCCCTGGGGCTTTCACAGCCAGG + Intergenic
1077523720 11:3051343-3051365 ACACTGGGCCTGTAACTGTGGGG - Intronic
1079578358 11:22030918-22030940 ACACTGGGGCCTGCAGGGTGTGG + Intergenic
1080751257 11:35152425-35152447 ACAATTAGGCTTTCACAGGGTGG - Intronic
1083748212 11:64746510-64746532 ACACTGGGACATTGAGAGTGGGG + Exonic
1086607907 11:88719224-88719246 ACACTGGGTGTTTCAGAGGGTGG - Intronic
1087554413 11:99696838-99696860 AGCCTGGGTCTTACACAGTGTGG - Intronic
1088513459 11:110600790-110600812 ACACTAGAGCTTTCCCACTGGGG + Intronic
1089004998 11:115083881-115083903 ACACTGGGCTTGGCACAGTGGGG - Intergenic
1089024622 11:115256563-115256585 ACACTGAGCCTTTCACTCTGAGG - Intronic
1091308328 11:134555124-134555146 ACACTGAGGCTTTGATACTGGGG + Intergenic
1091825831 12:3511996-3512018 ACACTGGGGCCTTGGGAGTGTGG + Intronic
1093090364 12:14913449-14913471 ACACTGGGGCTTTCACAGTGTGG + Intergenic
1093611902 12:21171140-21171162 TCAGTGGAACTTTCACAGTGAGG - Intronic
1094485806 12:30925675-30925697 ACACTGGGGCTGTAACATTGTGG - Intergenic
1095970555 12:47899270-47899292 ACACTGGGAATTTAACAGTGGGG - Intronic
1098564618 12:71919097-71919119 ACACTGGGGATTACACATGGGGG - Intronic
1099036227 12:77590496-77590518 ACACTGGGGTTATCAGAGGGTGG + Intergenic
1100037110 12:90265453-90265475 ACACTGGGGCTTTTTGAGGGTGG + Intergenic
1101238652 12:102815652-102815674 GCACTGTGGCTTTCAGAGGGAGG + Intergenic
1101408242 12:104447727-104447749 ACACTGGGGGTTCCACAAGGTGG - Intergenic
1104351486 12:128047920-128047942 CCACTGGGGATTGAACAGTGAGG - Intergenic
1105402696 13:20109781-20109803 CCAATGTTGCTTTCACAGTGAGG + Intergenic
1107950425 13:45456545-45456567 TGACTGGGGCTGTCACAGTGTGG - Intergenic
1108524746 13:51277310-51277332 ACACTGGAGCCTCCACAGGGTGG + Intronic
1108546523 13:51500885-51500907 CCACTGGGACTGCCACAGTGAGG + Intergenic
1108642570 13:52396169-52396191 ACACTGGGGGTTACAAAGTCAGG + Intronic
1108976592 13:56451691-56451713 ACACAGGGGTATTCACAGGGTGG - Intergenic
1109102771 13:58207251-58207273 ACACTGAGGGTTTCACAGTGGGG + Intergenic
1109523013 13:63536728-63536750 AGACTGCATCTTTCACAGTGAGG + Intergenic
1110677206 13:78263074-78263096 ACACTGGGGGTTACACATTTTGG - Intergenic
1111540813 13:89665055-89665077 AGACTAAAGCTTTCACAGTGTGG - Intergenic
1113627309 13:111856682-111856704 ACACCGGGGCCTCCACACTGGGG - Intergenic
1113681203 13:112246216-112246238 ACATTGGGGATTCCAGAGTGGGG - Intergenic
1113836680 13:113332683-113332705 TCACTGGGCCTTTGTCAGTGTGG - Intronic
1113855334 13:113441480-113441502 ACACTGTGGCATACACGGTGTGG + Intronic
1115205935 14:30904296-30904318 CCAGTGGGGCTTACTCAGTGGGG - Intronic
1115840539 14:37464566-37464588 ACACTGGGGATTCCAAAGTGGGG + Intronic
1115945704 14:38657774-38657796 ACAATGGGGCTTGCTCAGTATGG - Intergenic
1117644721 14:57839582-57839604 ACACTGGGGCCTTTTCAGGGAGG + Intronic
1118215955 14:63808674-63808696 ACACAGGGCCTTTGACATTGTGG - Intergenic
1118648747 14:67867678-67867700 AAACTGGGGCTCTCATAGCGAGG + Intronic
1118807478 14:69250621-69250643 ACACTGGGGCCTGCAATGTGAGG + Intergenic
1119790076 14:77342062-77342084 ACCCAGTGGCTTTCACAGAGCGG + Intronic
1122402576 14:101476057-101476079 ACAATGATGCTTTCACAGGGCGG - Intergenic
1125380663 15:39083327-39083349 ACACTGTGGCTAACTCAGTGAGG - Intergenic
1125501015 15:40240365-40240387 ACACTGGGGCATGCCCTGTGGGG - Intronic
1126115656 15:45205221-45205243 TCATTGAGGTTTTCACAGTGAGG + Intergenic
1126942639 15:53783039-53783061 ACACTGGGGATTCCAAAGTGGGG - Intergenic
1129653416 15:77507311-77507333 ACACTCTGCCTTTTACAGTGGGG - Intergenic
1129893406 15:79086902-79086924 GCACTTGGGCTTTCAGTGTGTGG + Intronic
1129909968 15:79219160-79219182 TCACTGAGACTTTCACAGTTTGG + Intergenic
1130398465 15:83526648-83526670 ACACTGGGCCTTCCAGAGGGTGG + Intronic
1131798105 15:96041284-96041306 ACACTGGGCCTCTCAGAGAGTGG + Intergenic
1133087306 16:3374908-3374930 ACTCTGAAACTTTCACAGTGTGG - Intronic
1134271807 16:12739608-12739630 ACACTGGGGCTGCAAGAGTGGGG + Intronic
1135240812 16:20806155-20806177 ACCCTGGGGCCTTGACTGTGTGG - Intronic
1135938688 16:26802638-26802660 ACACTGGGGCTTCCACCCTGTGG - Intergenic
1136293616 16:29290003-29290025 ACACTGGGCCTGCCACAGGGAGG - Intergenic
1136586867 16:31192021-31192043 ACTCTGGGTCTTTCACAGGAAGG + Exonic
1139237104 16:65351406-65351428 AAACAGGGGGTTACACAGTGAGG + Intergenic
1141223223 16:82090976-82090998 AGACTGGAGCTTTCCAAGTGGGG + Exonic
1141249239 16:82339722-82339744 AAACTGGGGCTTTCAGAGGAAGG + Intergenic
1142099498 16:88264009-88264031 ACACTGGGCCTGCCACAGGGAGG - Intergenic
1150746983 17:67824807-67824829 TTACTGAGGCTTTCCCAGTGCGG + Intergenic
1151368134 17:73630394-73630416 ACACTTGGGCTCTCAGAATGTGG + Intronic
1151457171 17:74233004-74233026 ACACAGGGGATTTCAGAGAGTGG - Intronic
1151666377 17:75547393-75547415 CCACTGTGTCTTACACAGTGAGG - Intronic
1152206001 17:78974650-78974672 ACACTGGGGCCTCCGCAGGGAGG + Intronic
1155161765 18:23201915-23201937 GCCCTGGGGCTATCCCAGTGGGG + Intronic
1156039443 18:32803903-32803925 ACACTGGGACTTTGAAAATGAGG - Intergenic
1156234212 18:35185394-35185416 ACACTGGGGACTCCAAAGTGGGG + Intergenic
1157907933 18:51586159-51586181 ACTCTGAGGCCTTCACATTGAGG - Intergenic
1158726847 18:59981126-59981148 AAACTGGAGCTTAGACAGTGAGG + Intergenic
1160233546 18:77067596-77067618 ACACTGGAGCTTTCACTGAGCGG + Intronic
1160523628 18:79522885-79522907 ACACTGTGGCTTGCCCAGCGGGG + Intronic
1161576039 19:5055000-5055022 ACACTGGGGCGTCCACAGCGAGG + Intronic
1165181473 19:33975214-33975236 ACACTGTGGGTTTCACCTTGGGG - Intergenic
1166268883 19:41701480-41701502 ACACTGGGCCTTTCCCAGTGGGG - Intronic
1168474075 19:56663643-56663665 ACACCTGGGCTCTCACAGGGAGG - Exonic
927016707 2:18970950-18970972 AAACTGCTTCTTTCACAGTGTGG + Intergenic
928898601 2:36293577-36293599 ACACTGCGGGATTCACAGGGAGG - Intergenic
929314666 2:40463019-40463041 AAAATGGGGCTTTCATCGTGGGG + Intronic
930599868 2:53430618-53430640 ACCCAGGGGCCTTCCCAGTGTGG + Intergenic
930908135 2:56598539-56598561 ACACTGGGCCTTTCAGGGGGTGG - Intergenic
933698426 2:85237423-85237445 TGTCTGGGGCTTCCACAGTGTGG + Intronic
937072898 2:119077778-119077800 ACACTGGGGACTTCACAGAGGGG + Intergenic
937207447 2:120245759-120245781 CCTCTGGAGCTTTCCCAGTGGGG + Intronic
937836383 2:126474410-126474432 ACACTGGGGGTATCAGAGAGTGG + Intergenic
943700374 2:190982625-190982647 ACACAGGTGCTTTCACAGTAGGG + Intronic
945418743 2:209607825-209607847 AGACTGGGGCTTTCAGAATTAGG - Intronic
945849237 2:214985388-214985410 ACAGTGGGGCTTTCGGAGGGTGG + Intronic
948622237 2:239243547-239243569 ACAGTGGGGTGTGCACAGTGAGG - Intronic
1168972736 20:1941832-1941854 ACACATGGGCTTTTACAGTTGGG - Intergenic
1169199533 20:3701524-3701546 ACACTGGTGCTGTCACATGGGGG - Exonic
1169226742 20:3861627-3861649 ACCCTAGGGCTTCCTCAGTGGGG + Intronic
1169500145 20:6151676-6151698 ACACTGGGAATTACAGAGTGGGG - Intergenic
1175553414 20:59831457-59831479 ACACTCAGGCTTTCTCAGTGGGG + Intronic
1175732689 20:61364825-61364847 CCCTTGTGGCTTTCACAGTGCGG + Intronic
1177061085 21:16375114-16375136 ACACTAGGGCTTTTCAAGTGGGG - Intergenic
1178562223 21:33649256-33649278 ACACTGAGGCCTTCACATTCAGG - Intronic
1178908786 21:36657668-36657690 ACACTGGGCCTTTCTGAGGGTGG + Intergenic
1179933238 21:44585957-44585979 ACACTGGGGCTCTCAGGGTGGGG + Intronic
1185297240 22:50060459-50060481 GCCCTGGGGCCTTCTCAGTGAGG + Exonic
949564848 3:5235150-5235172 GCTCTGGTGCTTCCACAGTGTGG - Intergenic
952273409 3:31854302-31854324 ACACTTGGGCTTGGAGAGTGAGG - Intronic
952332139 3:32373915-32373937 ACACTGGGGCTATAAGAGGGTGG - Intergenic
952497639 3:33929770-33929792 ACACTGGGGCTGTCAGTGGGAGG - Intergenic
953280913 3:41556010-41556032 ACACTGGGCCTTTCAGAGGGTGG + Intronic
954866622 3:53735303-53735325 ACACTGGGTCCTTAAGAGTGTGG - Intronic
955588823 3:60512577-60512599 AAACTGTGTCTTTTACAGTGGGG + Intronic
955717819 3:61849057-61849079 ACACTGGGCCTTTTGCAGTTGGG + Intronic
956112603 3:65884752-65884774 ACACTGGGCCTCCCAAAGTGGGG - Intronic
957531935 3:81451647-81451669 ATCCTGGGGCTTTCACAGAATGG + Intergenic
958661918 3:97079432-97079454 ACACTGGGCCTATCAGAGGGTGG + Intronic
959859709 3:111203582-111203604 TCACTGGGGCTTACATACTGGGG + Intronic
959963023 3:112322063-112322085 CCACGGGCGCTTTCACAGGGAGG + Intergenic
960617579 3:119609982-119610004 ACACTGGGGATTTCAAAAGGGGG - Intronic
961157543 3:124692992-124693014 ACCCTGGAGATTTCACAGTAGGG - Intronic
961829507 3:129616240-129616262 AGACAGGGGCTTTCACAGGCTGG - Intergenic
962650400 3:137483115-137483137 ACACTGGGCCTTTCAGAGGGTGG + Intergenic
963930505 3:150999827-150999849 ACACTTGGGCTGAGACAGTGGGG - Intergenic
964293115 3:155203601-155203623 AGGGTGGGGCTTTCAAAGTGAGG + Intergenic
969472348 4:7396441-7396463 TCACAGGGGCTGCCACAGTGAGG - Intronic
972173319 4:36374856-36374878 AGAGAGGGGCTTCCACAGTGCGG - Intergenic
972642045 4:40933861-40933883 ACACAGGGGCCTTCTCATTGTGG + Intronic
977590763 4:98824055-98824077 ACACTGGGGATTCCAAACTGGGG + Intergenic
978054648 4:104248863-104248885 ACACTGGGGCTGTGGCAGTGGGG + Intergenic
978109321 4:104943586-104943608 ACACTGGTGCTTTCCCCCTGTGG + Intergenic
980220673 4:129909713-129909735 ACATTGGGGCTTTCAGAGGCTGG + Intergenic
981118341 4:141018410-141018432 ACACTGGGGGTTTCACAAGCAGG - Intronic
983135888 4:164079951-164079973 ACACTGGGGCATGAATAGTGAGG - Intronic
984964246 4:185127344-185127366 ACACTGAGGCCTGCACGGTGGGG + Intergenic
985668531 5:1194396-1194418 ACACTGGGCCTGTCAGAGGGTGG - Intergenic
985823253 5:2175294-2175316 ACCCTGGGTCCTGCACAGTGGGG - Intergenic
986937760 5:12912267-12912289 ACACTGGGGCTTTTGGAGGGTGG + Intergenic
987076605 5:14388254-14388276 ACACTTTGGTTGTCACAGTGGGG + Intronic
988132295 5:27120712-27120734 ACAACAGTGCTTTCACAGTGTGG - Intronic
990019087 5:51102930-51102952 AAACTGCGGATTTCACAATGTGG + Intergenic
990904678 5:60791348-60791370 ACACTGGGGACTTCAAAATGGGG + Intronic
992290603 5:75275534-75275556 ACTCTGGGGCTCCCACTGTGTGG + Intergenic
993727949 5:91389910-91389932 ACACTGGACCTTTCAAAGGGTGG + Intergenic
993785679 5:92132319-92132341 ACACTGGGGCTTTCAGAGGTCGG - Intergenic
994119456 5:96097490-96097512 ACACTGTGGCCTTCAGAGTGGGG - Intergenic
998505633 5:142669856-142669878 GCACTGGGGATCTCAGAGTGTGG - Intronic
1000714419 5:164623014-164623036 ACATTGAGGCTGTAACAGTGAGG + Intergenic
1001490402 5:172150826-172150848 ACTGTGGGCCTTTCTCAGTGTGG - Intronic
1002421815 5:179152994-179153016 ACACTGAAGCTCCCACAGTGTGG + Intronic
1002713209 5:181207467-181207489 CCACTGGAGCTCTCACCGTGTGG - Intergenic
1004754342 6:18595695-18595717 ACAGTCGGGGTTACACAGTGAGG + Intergenic
1004845591 6:19638374-19638396 ACACTGGGGCTGTCAGGGAGTGG - Intergenic
1007284569 6:40738284-40738306 AGACTGGGGCTTTCTCAGGACGG + Intergenic
1007344857 6:41221942-41221964 ACACTCTGGCTGTCACAGGGTGG + Intergenic
1008667876 6:53734771-53734793 ACACTGAGCCTTTAACTGTGAGG + Intergenic
1009059947 6:58386998-58387020 AGACTGTGGCTCTCACAGAGAGG + Intergenic
1009471877 6:64036602-64036624 AAACTAAGGCTGTCACAGTGGGG + Intronic
1009754449 6:67918520-67918542 ACACTGGGGCTTACTGGGTGTGG + Intergenic
1010137080 6:72567919-72567941 ACACTGGGGCCTCCAAAATGGGG + Intergenic
1010467091 6:76180754-76180776 ACACTGGGGCTTTTGGAGGGTGG - Intergenic
1011075182 6:83431065-83431087 CCGCTGGGCCTTTCCCAGTGCGG - Exonic
1016938383 6:149465407-149465429 ACTCTGAGGCTTGTACAGTGAGG + Intronic
1017731527 6:157321454-157321476 ACACAAGGACTTTCACAGTTTGG + Intronic
1017795463 6:157840239-157840261 AGGCTGGTGCTTGCACAGTGAGG + Intronic
1019526642 7:1483394-1483416 AAACTCGGGATTTCACCGTGTGG - Intronic
1020143439 7:5624831-5624853 CCTCTGGGGCTTGCCCAGTGTGG - Intronic
1024140653 7:46460072-46460094 ACTGTGGGGCTCTCACAGTCAGG + Intergenic
1026620065 7:71942387-71942409 ACACGGGGCCTTTTACACTGCGG - Intronic
1031269772 7:119633885-119633907 ACACTGGGCCTTTCAGAGGGTGG - Intergenic
1032459193 7:132096908-132096930 AAGCTGGGGCTTTCACAATGTGG + Intergenic
1032662553 7:134001335-134001357 ACACTGCTGATTACACAGTGGGG - Intronic
1034362353 7:150511407-150511429 AAATTAAGGCTTTCACAGTGAGG + Intergenic
1035369231 7:158368498-158368520 ACACTGAGCTTTTCAAAGTGTGG - Intronic
1037063025 8:14539703-14539725 ACACTGGGGACTTCAGAGCGTGG - Intronic
1037715239 8:21391942-21391964 ACACAGGAGCTTTCAGAATGAGG - Intergenic
1040328788 8:46375520-46375542 GCAGGGGGGCTTTCACAGTTGGG - Intergenic
1046388568 8:113537248-113537270 ACACTGGGGCTATCAGAGAGTGG - Intergenic
1046458461 8:114501691-114501713 ACACTGGGCCTTTCAGAGGGAGG + Intergenic
1047796007 8:128256739-128256761 ACACTGGCCCTGTCAGAGTGTGG + Intergenic
1049449508 8:142652919-142652941 GTACTGGGGCCTTCACAGAGGGG - Intergenic
1049513244 8:143040198-143040220 ACACAGGGGCAGTCACAATGGGG - Intronic
1051880380 9:21833901-21833923 ACACTGGCACTTTCAAAGAGAGG - Intronic
1052067282 9:24037631-24037653 TTACTGGTGCTTTCTCAGTGTGG - Intergenic
1055232131 9:74078289-74078311 CTTCTGGGGCTTTCACAGTGGGG + Intergenic
1056094121 9:83233218-83233240 ACACTGGGGATTCCAAAATGGGG - Intergenic
1056655429 9:88504835-88504857 TGACCCGGGCTTTCACAGTGAGG + Intergenic
1058209178 9:102146111-102146133 ACTCTTGAGCTTTCACATTGTGG - Intergenic
1059554219 9:115262662-115262684 ACAATGGTGTTTGCACAGTGTGG + Intronic
1059571055 9:115436248-115436270 ATGCTGGGGCTTTTACAATGTGG - Intergenic
1059824540 9:118013472-118013494 ACACTGGGGCTTCCAGAGGGTGG - Intergenic
1060440593 9:123635487-123635509 ACCCTGTGCCTTCCACAGTGTGG + Intronic
1186913713 X:14197241-14197263 ACACTGGGGGCTCCAAAGTGGGG - Intergenic
1186981139 X:14958821-14958843 TCAATCTGGCTTTCACAGTGAGG - Intergenic
1188149131 X:26650650-26650672 ACACTGTGGCACCCACAGTGTGG - Intergenic
1188681303 X:33010835-33010857 ACACTGTGGTTCTCAAAGTGTGG + Intronic
1190679115 X:52809753-52809775 ACAGTGGGTCTTTTAAAGTGGGG - Intergenic
1190907279 X:54739391-54739413 ACACTGGGGCTCACAAAGAGTGG - Intergenic
1193181262 X:78459913-78459935 ACACTGGAGCTACTACAGTGAGG - Intergenic
1197584391 X:128327377-128327399 ACACTGGGGACTCCAAAGTGGGG - Intergenic
1200903429 Y:8456934-8456956 ACAGTGGGGTGTTGACAGTGGGG + Intergenic
1200903430 Y:8456948-8456970 ACAGTGGGGTGTTCACAGTGAGG + Intergenic
1201417903 Y:13766261-13766283 AAACAGTGGCTTTCAAAGTGTGG - Intergenic
1201499641 Y:14627734-14627756 AGAGAGGGGCTTTCATAGTGTGG + Intronic
1201536554 Y:15054834-15054856 ACACTGGGGCCTTCAAAGGGTGG - Intergenic
1202110851 Y:21417887-21417909 ACACTGGGGACTCCAAAGTGAGG + Intergenic