ID: 1093091930

View in Genome Browser
Species Human (GRCh38)
Location 12:14931656-14931678
Sequence GTCATCAGTGAAGCTTTATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 118}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093091930 Original CRISPR GTCATCAGTGAAGCTTTATG AGG Intronic
900685533 1:3945544-3945566 TTCAGCAGTGAAGCTGTCTGCGG - Intergenic
901806102 1:11739672-11739694 GTCATCCGTGTAACTGTATGGGG - Intronic
904610593 1:31724161-31724183 GGCATCAGTGAATCTTTAGCGGG - Intergenic
911310851 1:96290103-96290125 GTAAGCAGGGAAACTTTATGAGG - Intergenic
911955385 1:104227564-104227586 GTAATCAGTGTTGCTTTAAGTGG + Intergenic
914871097 1:151474681-151474703 TTCATCAGTGAAGCTTTGTGTGG + Intergenic
914896713 1:151681962-151681984 GTTATCAGGGAAGCCTTAGGTGG - Intronic
918273407 1:182925663-182925685 GTCATATGTGCAACTTTATGAGG - Intronic
923885766 1:238153566-238153588 GTCTTCAGTGCATCTTTCTGTGG - Intergenic
1065394949 10:25225255-25225277 ATAATCAGAGAATCTTTATGGGG + Intronic
1068328606 10:55530339-55530361 TTCATATGTGAAGCTTTTTGGGG - Intronic
1068738797 10:60445761-60445783 GTCATCAGGGAAATTTTAAGGGG + Intronic
1068948674 10:62755447-62755469 ATCATCACTGCAACTTTATGAGG - Intergenic
1069120636 10:64565706-64565728 TTCACCAGTGAAGCTTAATTTGG + Intergenic
1069969733 10:72156274-72156296 GCCATAATTGAAGCTTTCTGAGG + Intronic
1070765077 10:79051765-79051787 GTCCTCAGTGCAGTTTTCTGTGG - Intergenic
1076180334 10:128402115-128402137 GTCATCCCTGAAGGTTTCTGTGG + Intergenic
1077707756 11:4504196-4504218 CTCATCAGTGAACCTTTGTGTGG + Intergenic
1086829391 11:91540923-91540945 ATCATTATTGAAGCTTTATTAGG - Intergenic
1090937979 11:131362147-131362169 GTCATCAGCGTAGCTTTTGGTGG + Intergenic
1093091930 12:14931656-14931678 GTCATCAGTGAAGCTTTATGAGG + Intronic
1093569151 12:20645590-20645612 CTAATCAGTGAAGTATTATGAGG + Intronic
1093858670 12:24136540-24136562 GTCATCAGAGCATCTCTATGAGG - Intergenic
1097427841 12:59469000-59469022 TTCATCAGTGAAACTGTCTGAGG - Intergenic
1106584023 13:31042016-31042038 GACATCAGTGAAGGTTTGTGGGG + Intergenic
1107023273 13:35773820-35773842 GTCATCAGTACATCTTCATGTGG + Exonic
1107636561 13:42398225-42398247 GACATCAGGGAAGCTCTTTGTGG - Intergenic
1107966942 13:45605455-45605477 TTCATCATTGCAGCCTTATGCGG + Intronic
1112760108 13:102686051-102686073 GTCATCAGTCAAACTTTTTAAGG - Exonic
1114895258 14:26981804-26981826 GTCATTACTGAAGATTTTTGAGG + Intergenic
1119754025 14:77101237-77101259 GTAGTAAGTGAGGCTTTATGTGG + Intronic
1124864814 15:33478679-33478701 GTCATCATTGAAGATTACTGTGG - Intronic
1125282429 15:38056919-38056941 GTCATGAGAAAAGGTTTATGAGG - Intergenic
1125338985 15:38655899-38655921 TTCTTCAGTGAAGCTCAATGTGG - Intergenic
1125421182 15:39506141-39506163 GTCCTCAGAGAAACTCTATGTGG - Intergenic
1128047291 15:64629938-64629960 TTCATCAGTGAAACTGTATTAGG - Intronic
1131419348 15:92291208-92291230 GTCATCTGTAAAGCTTCACGGGG - Intergenic
1132901589 16:2257993-2258015 GTCCTCAGTGCAGCATTTTGAGG - Intronic
1138141106 16:54569226-54569248 GTCATCAGACAATATTTATGTGG - Intergenic
1138899326 16:61250053-61250075 GGCATCAGGGAGGCTTTGTGTGG - Intergenic
1139873116 16:70123536-70123558 GACATCAAGGAAGCATTATGAGG - Intronic
1140362661 16:74357765-74357787 GACATCAAGGAAGCATTATGAGG + Intergenic
1148573257 17:48687914-48687936 GTCCTGAGTGGAGCTTTGTGAGG - Intergenic
1156865351 18:41883290-41883312 AACATCAGTGAAGCTTTATAAGG + Intergenic
1160360383 18:78270355-78270377 GTCAACAGTTAAGCTTTTTCTGG + Intergenic
1164065402 19:21710583-21710605 GTAATCTGTGAAGTTTTTTGGGG - Intergenic
925296732 2:2782014-2782036 GTCATCAGTGACACTTGGTGTGG + Intergenic
925486317 2:4335961-4335983 TTCAGCACTGAAGATTTATGGGG - Intergenic
932802072 2:74749866-74749888 GTCATAAATGAAGAATTATGAGG - Intergenic
933663421 2:84945827-84945849 GACATCAGTGGAGTTTTTTGGGG + Intergenic
934611141 2:95737341-95737363 GACATCGGTGGAGCTTTCTGAGG + Intergenic
937197102 2:120167790-120167812 GTCATTAGTGAAGCTTGATTTGG + Intronic
937948598 2:127365612-127365634 GTCCTCAGTCAAGCTTTTGGTGG - Intronic
941835775 2:170018652-170018674 GGAATCAGTGAAGCTTTTGGTGG + Intronic
942300702 2:174558766-174558788 GTCATCAGAGAAGTATTATTAGG - Intergenic
943836127 2:192516097-192516119 GTCATCAATGAAACTGGATGAGG - Intergenic
945313109 2:208338966-208338988 GTCATCATAGAAACTTTGTGGGG + Intronic
947170013 2:227301379-227301401 CTCATCAGTGATGCGTAATGAGG + Intronic
1169427549 20:5508475-5508497 GTCATCAGTGCAGCCTTTTTGGG - Intergenic
1169607105 20:7334085-7334107 GTCATCAGTGGAGCTTTACTGGG + Intergenic
1169958671 20:11134202-11134224 CTAATGAGTGAAGATTTATGTGG + Intergenic
1170135682 20:13070986-13071008 GGAATCAAGGAAGCTTTATGTGG - Intronic
1173598191 20:44273621-44273643 TTCACCTGTGAAGCTATATGTGG + Intronic
1175594808 20:60222543-60222565 GTGATGAGTGATGCTTTAGGTGG + Intergenic
1175958485 20:62623272-62623294 TCCATCAGTGAAGTTTTCTGTGG + Intergenic
1181799834 22:25338420-25338442 GACTTCAGTGAATTTTTATGTGG - Intergenic
1182612142 22:31557524-31557546 GTTATCAGTAAATCTTTATTAGG - Intronic
949381105 3:3446937-3446959 ATAATCAGAGAACCTTTATGAGG - Intergenic
951630141 3:24710954-24710976 GTCATCACAGAAGCTTCTTGAGG - Intergenic
951911749 3:27757833-27757855 GTCTTCCGTGAAGTTTAATGTGG + Intergenic
952446895 3:33389860-33389882 GCCAGCAGTGAATCTGTATGCGG - Exonic
953395418 3:42565473-42565495 GACATCAGTAAATCTTTTTGGGG - Intronic
956079709 3:65545148-65545170 GTCAGAAGTGACGCATTATGAGG - Intronic
956332624 3:68128051-68128073 TACATCAGTGACTCTTTATGAGG - Intronic
957828523 3:85484254-85484276 GTCAGCATTGAAACTTTCTGGGG + Intronic
958919621 3:100090044-100090066 AACATCAGTGAAGTTTTCTGTGG - Intronic
960241519 3:115347776-115347798 GTCATCAGTTGATCTTTATATGG + Intergenic
960705195 3:120474895-120474917 GTCATCACTGAACATTTATGGGG + Intergenic
962286162 3:134087076-134087098 GTCATCAGTGCCGCTCTGTGAGG - Intronic
962881446 3:139580457-139580479 CTCACCAGTGAAGTTTTGTGAGG + Intronic
964565866 3:158051875-158051897 TTCCTCAGAGAAGCTTCATGAGG + Intergenic
966830753 3:184006264-184006286 GGCATCCATAAAGCTTTATGAGG - Intronic
967593932 3:191308757-191308779 ATTATCCCTGAAGCTTTATGGGG + Intronic
968684909 4:1951556-1951578 GTCATCAGTGAAGCTAAAACAGG - Intronic
970695826 4:18675907-18675929 TTCCTCATTGAAGGTTTATGGGG + Intergenic
971531268 4:27692477-27692499 GTCATCAGGGAATCTGTAGGTGG - Intergenic
974618825 4:64328235-64328257 GTCGTCTGTGAAGCTTTAACTGG - Intronic
977155703 4:93570302-93570324 GTCAACAGTGAGGCTGAATGAGG - Intronic
977216562 4:94292107-94292129 GTCTTCATTAAAGCTTGATGTGG + Intergenic
977798607 4:101198480-101198502 GGCAACAGTGAAGGTTTAAGTGG + Intronic
979933293 4:126659607-126659629 TTAATCAGTGAAGCTTTGAGGGG + Intergenic
981214807 4:142151622-142151644 GTGATCAATGAAGATTAATGTGG - Intronic
981858257 4:149321943-149321965 CTCATCAGTGAATCTTCATCAGG + Intergenic
982905319 4:161061220-161061242 GTCATCAGTTAAGGTTTAACTGG - Intergenic
985102754 4:186474721-186474743 GACATAATTGAGGCTTTATGAGG + Intronic
988238618 5:28578568-28578590 GTTTTCATTGAAGTTTTATGCGG - Intergenic
988411420 5:30890622-30890644 GACATCAGAGAAGCTTATTGAGG - Intergenic
992634892 5:78717898-78717920 GTCAGCAGAGCAGCTTTGTGGGG - Intronic
997587849 5:135054398-135054420 GTCATCAGTTAACCTTGCTGGGG + Intronic
997846081 5:137287146-137287168 GTCATCAGCCAAGCATTATGGGG + Intronic
998825218 5:146094531-146094553 GGCCTCAGAGAAGGTTTATGTGG - Intronic
1004255612 6:14060729-14060751 TTCATCATTGGAACTTTATGAGG - Intergenic
1008302458 6:49857920-49857942 GTCAACAGGGAAACTCTATGGGG - Intronic
1011218135 6:85027372-85027394 GGCAACAGAGAAGCTTCATGAGG - Intergenic
1018455165 6:163945198-163945220 ATCATCAGTGAATATTTATTAGG + Intergenic
1020892962 7:13902595-13902617 GACATCAGTGAACCTTTAATAGG + Intronic
1022130188 7:27397722-27397744 CTCATCAGTAAAGGTTTCTGTGG + Intergenic
1024109204 7:46128425-46128447 TTCCTCAGTGAAGGTTTAAGGGG - Intergenic
1024946382 7:54811881-54811903 GTCAACAGTGAAGCCGCATGGGG + Intergenic
1026663735 7:72324330-72324352 GTTATCAGTGATGCTTTTTCAGG - Intronic
1028076385 7:86521264-86521286 GTCATCATTGTAGCATGATGGGG - Intergenic
1028481935 7:91316542-91316564 GCAATCAGTGAAGCTGTTTGGGG - Intergenic
1028887453 7:95949679-95949701 CTCATCAGTGAGGATTTAAGAGG + Intronic
1029495375 7:100893536-100893558 GACATCAGTGACGCTGTTTGGGG - Exonic
1031516864 7:122711579-122711601 TTAATCAGGGAAGCTTTGTGGGG - Intronic
1032952608 7:136932315-136932337 GTCCTCATTTGAGCTTTATGAGG - Intronic
1042031079 8:64476253-64476275 GTCATAACTGAAGCATTTTGTGG - Intergenic
1045018549 8:98020736-98020758 GGCAGCAGTGAAGCTCTCTGAGG + Intronic
1046777482 8:118179475-118179497 GTCTTCAGGGATGCTTAATGTGG + Intergenic
1047843030 8:128774982-128775004 ATCATCAGTGAAGCTTTTTGAGG + Intergenic
1050208640 9:3227678-3227700 ATCATCAGTGTTGCTTTATGTGG + Intronic
1055917874 9:81425334-81425356 CTCATCATTGTAGCTCTATGAGG + Intergenic
1059845896 9:118276176-118276198 GTGATCAGTGAAGCTTAGTAGGG - Intergenic
1062407685 9:136404715-136404737 GACATCAGTGATGCTTTTTGTGG - Intronic
1189100982 X:38189401-38189423 GTCCTCAGTGCAACCTTATGAGG + Intronic
1190243357 X:48675047-48675069 GTCATCATTGAATGTTTCTGAGG - Intergenic
1190333186 X:49248135-49248157 GTCATCTGTGGAGCTCCATGGGG + Intronic
1192426542 X:71082073-71082095 GTCATCCTTGAAGCTTTTAGTGG + Intergenic
1194404532 X:93478432-93478454 TTCATCAGTGAAGCCATGTGGGG - Intergenic
1196158501 X:112456611-112456633 GTCTTCAGTGGAGATTTATTTGG - Exonic