ID: 1093092092

View in Genome Browser
Species Human (GRCh38)
Location 12:14933461-14933483
Sequence CTGGATAAATGTAGTTTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 270}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093092086_1093092092 23 Left 1093092086 12:14933415-14933437 CCTAAAAAGGGTTCATTGAGTTT 0: 1
1: 0
2: 1
3: 19
4: 208
Right 1093092092 12:14933461-14933483 CTGGATAAATGTAGTTTTAATGG 0: 1
1: 0
2: 1
3: 34
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093092092 Original CRISPR CTGGATAAATGTAGTTTTAA TGG Intronic
902068178 1:13706800-13706822 TTGCATGTATGTAGTTTTAAGGG + Intronic
902123676 1:14190133-14190155 CTGAATTGATGTACTTTTAATGG - Intergenic
903683078 1:25110422-25110444 CAATATAAATGCAGTTTTAACGG - Intergenic
904133610 1:28293746-28293768 CTGTATAAATTTGGTTTGAAAGG - Intergenic
904218822 1:28947524-28947546 CTGAATAACTGTATTTTTAACGG - Intronic
906294964 1:44644081-44644103 CTGGACAAGTGCAGTTATAAAGG - Intronic
906840326 1:49131398-49131420 CTCGATAAATTGAATTTTAAAGG + Intronic
908129782 1:61063769-61063791 CTGGCTAATTGTATTTTTAGTGG + Intronic
908491422 1:64648041-64648063 TTGGATAAACGTCATTTTAAAGG + Intronic
909522668 1:76587708-76587730 CTTGATAAATGGAATTTAAAAGG + Intronic
909841063 1:80324642-80324664 CTGGATAAATGTAATCTCAAAGG + Intergenic
910063875 1:83128618-83128640 CTTGATTACTGTAGTTTTATAGG - Intergenic
910521008 1:88122489-88122511 CTGGTTAAATATTATTTTAAAGG + Intergenic
910533635 1:88270670-88270692 CTGGAGAATTCTGGTTTTAAAGG - Intergenic
910891467 1:92024955-92024977 CTGGATTAATTTAGCTTTTAAGG + Intergenic
914736387 1:150421369-150421391 CTGGATAAATGAAGATATATAGG + Intronic
915863605 1:159474532-159474554 CTTGAGAACTGTAGTTTCAAGGG - Intergenic
916771654 1:167914665-167914687 CTGGAAAAATGTATTTTAAGAGG + Intergenic
917621075 1:176796513-176796535 CTGGTTAAATGTCTTGTTAAAGG - Intronic
917831330 1:178891523-178891545 GTTGATAAATGATGTTTTAAAGG - Intronic
920120863 1:203656972-203656994 CTGCATAAATGCAGTCTTACTGG - Intronic
922943023 1:229484937-229484959 GTGATTAAGTGTAGTTTTAAAGG - Intronic
924497944 1:244608231-244608253 GTCCTTAAATGTAGTTTTAATGG - Intronic
1063560563 10:7122475-7122497 CTTAATAAATGTATTTTTAAAGG - Intergenic
1065449958 10:25846820-25846842 CTTGATAAAATTAGTTTAAATGG + Intergenic
1069423593 10:68270047-68270069 CTAGCTAAATGGAGCTTTAAAGG - Intergenic
1069487210 10:68831479-68831501 CTGGCTAGATGTTTTTTTAAAGG + Intronic
1069504297 10:68983578-68983600 CTGGATAAATGGTGCTTAAATGG + Exonic
1072951207 10:99848100-99848122 CTGGACATAGGGAGTTTTAAAGG + Intronic
1074264137 10:111884142-111884164 CTCCATAAATGCAGTTTTTAAGG - Intergenic
1076602433 10:131667501-131667523 CTGGAAAACTTTAGCTTTAAGGG + Intergenic
1077294186 11:1816712-1816734 CTGGAAATATATATTTTTAAAGG - Intergenic
1077877787 11:6322131-6322153 CTGGGTAAATGTAGTTTCACTGG - Intergenic
1078372352 11:10759405-10759427 CTTGATAAAAGCAGTTTTACTGG + Intronic
1079661319 11:23040416-23040438 ATGCATAAATATAGTATTAAAGG - Intergenic
1079724749 11:23867217-23867239 GGTGATAAATGTAGTTTTAGTGG + Intergenic
1080260033 11:30338932-30338954 CTGCATAAATTGAGTTTTAATGG - Intergenic
1081372194 11:42317508-42317530 CTGGATGATCGGAGTTTTAAGGG - Intergenic
1082571177 11:54742360-54742382 GTGAATAAATTTAGCTTTAAAGG - Intergenic
1085866445 11:80300238-80300260 TTACATAAATATAGTTTTAAGGG + Intergenic
1088938846 11:114433542-114433564 CTTGATAAATGTTGATATAAGGG - Intronic
1090115832 11:123971878-123971900 TTTGATAAATGTAGATTTACAGG - Intergenic
1093092092 12:14933461-14933483 CTGGATAAATGTAGTTTTAATGG + Intronic
1093313645 12:17622287-17622309 TTAGATAAATGAAGTATTAATGG - Intergenic
1094686889 12:32726262-32726284 CTGGGTAATTTTTGTTTTAAAGG - Intronic
1095358877 12:41311454-41311476 CTGAATATCTGTAATTTTAAAGG + Intronic
1095607251 12:44084071-44084093 CTGGTTAAATATTGGTTTAAAGG + Intronic
1095811399 12:46375936-46375958 CTGGATAAATAGAATTTTGAGGG - Intergenic
1096913848 12:55011144-55011166 CTGGTTATATGTATTTCTAAGGG + Intergenic
1097656734 12:62373557-62373579 TTAAATAAAGGTAGTTTTAAAGG - Intronic
1098148520 12:67522491-67522513 CTGGATACATCTAATCTTAAAGG - Intergenic
1098730678 12:74034079-74034101 ATGGATTAATGTAGATGTAAGGG - Intergenic
1098745472 12:74232333-74232355 CTGGATAAATTTATTCATAAGGG + Intergenic
1099901561 12:88716760-88716782 CTGCCTAAATGTAGTTTTACTGG + Intergenic
1100144854 12:91665184-91665206 GTGGATAAATAAAGTTTTATTGG + Intergenic
1100671076 12:96813682-96813704 ATGGATGACTGTAGGTTTAAAGG - Intronic
1101302034 12:103492994-103493016 CTGGATTAAGGTAGTGTTAATGG - Intronic
1101518986 12:105464166-105464188 TTGAAGAAATGTAGTCTTAAGGG - Intergenic
1102784582 12:115594197-115594219 TTGGATACAAGTAGTTTTATTGG + Intergenic
1102802028 12:115743803-115743825 CTCAATAAATGTAGTTTAGATGG + Intergenic
1102974112 12:117193813-117193835 CTGGATAAGTTGAGTTTGAAGGG - Intergenic
1104136676 12:125946879-125946901 ATGAACAAATGAAGTTTTAATGG + Intergenic
1104191607 12:126486972-126486994 CAGGAAAAATGTAGTTGTAATGG + Intergenic
1104679812 12:130741774-130741796 TTTTATAAATGAAGTTTTAATGG + Intergenic
1105769723 13:23597282-23597304 CTGGATTAATTGATTTTTAAAGG - Intronic
1106012020 13:25833744-25833766 CTGGAAACATGTACTTTTCATGG + Intronic
1106083674 13:26521591-26521613 CTGGCTAATTGTATTTTTAGTGG - Intergenic
1106174448 13:27317908-27317930 GTGTATATATGTAGATTTAAGGG - Intergenic
1109049329 13:57458380-57458402 CTCAATAAAGGTAGTTGTAATGG + Intergenic
1109814524 13:67563285-67563307 CTGCATAAATGTCTTCTTAAAGG + Intergenic
1110088042 13:71407107-71407129 CAATATAAATCTAGTTTTAAGGG + Intergenic
1110689976 13:78421604-78421626 CTGGATATATGTGGTTATATAGG - Intergenic
1111599181 13:90449502-90449524 CTGGATAAGTGTATTGTTCATGG + Intergenic
1112101104 13:96190389-96190411 ATGGATACATGTACTTTTATTGG + Intronic
1114791140 14:25659792-25659814 TTGCATAAATGAAGTTCTAATGG - Intergenic
1115732506 14:36286571-36286593 CTGTTTAAATATAGTTTTTAAGG - Intergenic
1116048346 14:39772743-39772765 CTGGATAAGTGTATTTTACAAGG + Intergenic
1118709693 14:68509128-68509150 CTGGATAAAGGTGGTTTTCAAGG + Intronic
1119344074 14:73907431-73907453 CTGGCTAACTGTATTTTTAGTGG - Intronic
1120169251 14:81232544-81232566 CAAGATAGAAGTAGTTTTAATGG - Intergenic
1120510506 14:85408015-85408037 CTGGTGAAAAGTATTTTTAAAGG + Intergenic
1121883060 14:97517663-97517685 CTAGATAAATGCAGTTTTACAGG - Intergenic
1123473979 15:20575735-20575757 CTTGAAAAATATAGTATTAAAGG + Intergenic
1123644029 15:22424618-22424640 CTTGAAAAATATAGTATTAAAGG - Intergenic
1123734279 15:23170747-23170769 CTTGAAAAATATAGTATTAAAGG + Intergenic
1124040684 15:26100106-26100128 CTGGATTTATGTGTTTTTAATGG + Intergenic
1124848837 15:33316501-33316523 CTGGATAAATCTTGTATTAAGGG - Intronic
1126347101 15:47707821-47707843 TTGGGTAAATGGAGTTTAAAGGG - Intronic
1128279810 15:66385786-66385808 CTGGATGAAAGTTTTTTTAAAGG + Intronic
1128861363 15:71076683-71076705 ATGGATTAATGTAGTTATTATGG + Intergenic
1134258074 16:12627716-12627738 CTGGATAAAAAAAGTGTTAATGG - Intergenic
1134510286 16:14840961-14840983 CTGGCCAAATCTAGTTTTAGGGG + Intronic
1134697927 16:16239450-16239472 CTGGCCAAATCTAGTTTTAGGGG + Intronic
1134973906 16:18555231-18555253 CTGGCCAAATCTAGTTTTAGGGG - Intronic
1135838294 16:25849218-25849240 GTTGATAAATATATTTTTAAAGG + Intronic
1138163932 16:54782169-54782191 CTAGATAGATGTATTTTAAAAGG + Intergenic
1138864745 16:60803105-60803127 ATGGAGAAATGTAGTTTTGATGG - Intergenic
1139293412 16:65878321-65878343 GTGGAAAAATGTAGTTGAAATGG - Intergenic
1139408896 16:66742853-66742875 CTATATTACTGTAGTTTTAAAGG - Intronic
1141233452 16:82193267-82193289 TTGAATAAATGTAGTTTAGAAGG - Intergenic
1141299717 16:82802697-82802719 CTGGATTAATATAACTTTAAAGG + Intronic
1142749100 17:1977134-1977156 TTAGATAAATGTATTTTAAAAGG - Intronic
1143487863 17:7264646-7264668 CTGGATTAATGTACTCTTAGAGG + Intergenic
1146431785 17:32803472-32803494 CTGGAAATATGTATTTTAAAAGG + Intronic
1148116364 17:45177684-45177706 ATGGATAAATACAGTTTGAAGGG - Intergenic
1148930346 17:51122107-51122129 CAGGATAAACATAGGTTTAAGGG + Intergenic
1150045982 17:61913667-61913689 CTGGAAAAATATATTTTCAAAGG - Intronic
1150345151 17:64398827-64398849 CTGGTTAAATGTGCTTTCAAAGG - Intronic
1151063263 17:71121369-71121391 CTGAATAAATGAGTTTTTAAAGG + Intergenic
1152843032 17:82582067-82582089 CTGGATTAATTTACTTTTAATGG + Intronic
1156987963 18:43371493-43371515 CTGGAAGATGGTAGTTTTAAAGG - Intergenic
1157649064 18:49308964-49308986 CTTCATGAATGTAATTTTAATGG - Intronic
1158824130 18:61195234-61195256 CTGGAAAAATATTTTTTTAAAGG - Intergenic
1159247881 18:65833523-65833545 TTGGATTATTTTAGTTTTAAGGG + Intronic
1160139209 18:76305431-76305453 CTGGATAATTGTAGCTTTATAGG + Intergenic
1160216438 18:76936546-76936568 CAGGATAAATGAATATTTAAAGG + Intronic
1160235860 18:77086418-77086440 CTGGAGAAATGTTGTTTTTCAGG + Intronic
1160358521 18:78249226-78249248 CTGGCAAAATGCAGTTTTATTGG + Intergenic
1164889214 19:31808681-31808703 TTGGCTAAATGAAGTTTTGATGG - Intergenic
1164923083 19:32104213-32104235 CTGGAGAGCTGTAGTTTTGAGGG - Intergenic
1167556379 19:50198602-50198624 CTGCATAAATAAAGTTTTATTGG + Intronic
925094830 2:1188859-1188881 CTTAATAAATATATTTTTAATGG + Intronic
927313166 2:21652952-21652974 ATGGAAAAATGGAGTTTGAAAGG + Intergenic
927624002 2:24693400-24693422 CTGGATATAATTAGTTTTAAGGG - Intronic
928017783 2:27674435-27674457 CTGGATCAATGCATTTTTAATGG + Intronic
928923475 2:36551628-36551650 CTGAAGAAATGTAGCTTTAAAGG - Intronic
929196886 2:39193890-39193912 CTGTAAAAATATATTTTTAAAGG - Intronic
930430554 2:51270324-51270346 GGGGATAAATGTATTTTTCATGG - Intergenic
931147131 2:59531535-59531557 TTGCATAAATGTAGAGTTAAAGG - Intergenic
931553189 2:63469899-63469921 CTAGATAAAAGCAGTTTCAATGG - Intronic
932517167 2:72363761-72363783 CTTCATAAATGGAGTTGTAAGGG + Intronic
933060367 2:77729114-77729136 TTTGATAAAAGTATTTTTAAAGG + Intergenic
936510853 2:113144781-113144803 TTGGATAAAAGTCATTTTAACGG + Intergenic
936826873 2:116592467-116592489 CTGTATCAATTTAGATTTAATGG - Intergenic
937039001 2:118806814-118806836 CTGGATATATAAAGTTGTAATGG - Intergenic
937523952 2:122744433-122744455 TTGGATACATCTATTTTTAAAGG - Intergenic
937547246 2:123037246-123037268 CTGGAAAAAAATAGGTTTAACGG + Intergenic
937848495 2:126609274-126609296 ATGAATAAATGTAATTATAATGG + Intergenic
938643335 2:133305712-133305734 CAGGATAAAGCTAGTTTAAATGG - Intronic
938837870 2:135126446-135126468 CTGGATAAGAGTAAGTTTAAGGG + Intronic
939261225 2:139812322-139812344 CTGGATAAATGAATATTGAATGG + Intergenic
939784058 2:146486485-146486507 TTGTATAAATGTAGTTTGGAAGG - Intergenic
941146737 2:161856907-161856929 TTGGATTAATCTATTTTTAAAGG - Intronic
941580465 2:167291791-167291813 CTTGCTAATTGTATTTTTAAGGG - Intergenic
943177787 2:184500052-184500074 CTGGTTAATTGTAGCTTTGATGG - Intergenic
943403758 2:187453393-187453415 CTTGATAAATATAGTTACAAGGG + Intergenic
943734205 2:191336085-191336107 TTGGAAAAATGTAGTTTTGATGG - Intronic
944031512 2:195240272-195240294 CTGGATTTAGGTAGTTCTAAAGG - Intergenic
945473519 2:210254589-210254611 ATCAATAAATGTAATTTTAAAGG + Intergenic
948320307 2:237063606-237063628 AAGCATTAATGTAGTTTTAAAGG + Intergenic
1169173159 20:3483218-3483240 GTTGATAAATGTAGTTCTAGTGG + Intronic
1170130893 20:13018822-13018844 CTGTACTAATGTAGTTTTACTGG + Intronic
1170498761 20:16952890-16952912 CTTGATAATAGTAGTTTTTATGG + Intergenic
1174268542 20:49349950-49349972 CTCAATAAATCTTGTTTTAAAGG - Intergenic
1177494007 21:21865245-21865267 CTGGTTAAATGTATTTTGGATGG - Intergenic
1177550255 21:22611588-22611610 TTGCATAAATATAATTTTAAGGG - Intergenic
1177798116 21:25800568-25800590 CCAAAAAAATGTAGTTTTAATGG - Intergenic
1178848857 21:36196606-36196628 CTTCATAAATGATGTTTTAAGGG + Intronic
1178881433 21:36453259-36453281 CTGGCTCATTGTAGTTTTAATGG + Intergenic
1179286383 21:39980886-39980908 TGGAATAAATGGAGTTTTAATGG + Intergenic
1182317522 22:29457939-29457961 CTTGGGAAATGTAGTTTGAAGGG - Intergenic
1184164265 22:42718563-42718585 CTGGAAAAACGTGTTTTTAAAGG + Intronic
950813823 3:15677094-15677116 GTGTATAAATGTATCTTTAATGG - Intronic
951069897 3:18315236-18315258 TTGGATAAAAGCTGTTTTAACGG + Intronic
951335776 3:21419880-21419902 CCTGATAAATCTTGTTTTAAAGG + Exonic
952045009 3:29308291-29308313 CTGAATAAATGTATTTAGAATGG - Intronic
952291814 3:32024094-32024116 CTTGATTACTGTCGTTTTAATGG + Intronic
953523985 3:43671544-43671566 CTGTATAATTTTTGTTTTAAAGG + Intronic
955871093 3:63439329-63439351 ATGGATAAATGTTATTTTAAAGG + Intronic
955907921 3:63827087-63827109 CTCCATAAATGTATTTATAAAGG - Intronic
956459494 3:69456812-69456834 CTGGCTAAATAAAGTTTTATTGG + Intronic
956606973 3:71082997-71083019 CTGGATCTACGTGGTTTTAAGGG + Intronic
956734799 3:72230135-72230157 CTTCATAAATGAAGTTTTATTGG + Intergenic
956861278 3:73326481-73326503 CTGCATTCATGTATTTTTAATGG - Intergenic
957737624 3:84223662-84223684 TTATAAAAATGTAGTTTTAAAGG - Intergenic
957955980 3:87187502-87187524 CAGGATAAATGATGTATTAAAGG + Intergenic
958486868 3:94723720-94723742 CTGGAAAATTGTAGTGTAAATGG + Intergenic
960430755 3:117565691-117565713 GTGGATTAAGCTAGTTTTAAGGG + Intergenic
960543012 3:118881500-118881522 AAGGTTAAATGAAGTTTTAAGGG + Intergenic
960819083 3:121707731-121707753 CTGCATAAATAAAGTTTTATTGG + Intronic
964398912 3:156278344-156278366 CTGGTTCACTGTAGTTTTCAAGG + Intronic
966233515 3:177674630-177674652 CAGGATAAATGGAGTTCCAACGG - Intergenic
968202840 3:196770256-196770278 CTGTATATATATACTTTTAATGG - Intronic
969489206 4:7489564-7489586 CTGGATATCTGTATTTTAAATGG + Intronic
969743271 4:9049463-9049485 CTGTATAAATTAAGTTTTACTGG - Intergenic
972843997 4:42965557-42965579 CTGGTGAAATGTAATTTTAAGGG + Intronic
973638669 4:52882802-52882824 TAGGATAAATGTAGATATAAAGG - Intronic
973787748 4:54349314-54349336 CTGGACAAAAGCAGTTTTAGTGG + Intergenic
974263363 4:59553606-59553628 CTGGATGAATGTAAATTTAAAGG + Intergenic
975550638 4:75609119-75609141 CTAGAGAAAGTTAGTTTTAATGG + Intronic
976632591 4:87254001-87254023 CTGGCAAAATATACTTTTAAAGG + Intergenic
976874074 4:89833383-89833405 TTTGATAAATGAAGTTTTATTGG + Intronic
977746423 4:100554005-100554027 CTTGATCAGTGAAGTTTTAATGG - Intronic
978297425 4:107222606-107222628 CTCTTTAAATATAGTTTTAATGG - Intronic
978519242 4:109598775-109598797 CTGCATATATGTATTTTAAAAGG - Intronic
978855418 4:113388703-113388725 CTGGAAAAATATATTTATAAAGG + Intergenic
978884328 4:113748238-113748260 CTGGATAAATGAAGGTACAAAGG - Intronic
979397618 4:120207352-120207374 CTTGATAGAAGTAGTTTCAATGG + Intergenic
980261351 4:130452701-130452723 CTAGATAAATGTAGCATAAATGG + Intergenic
984020464 4:174478723-174478745 ATGTATATTTGTAGTTTTAAGGG - Intergenic
984849552 4:184142177-184142199 TTGGAGAAATGTAATTTTTATGG - Intronic
985206723 4:187546165-187546187 CTGGATAAATGCGATTTTAGTGG - Intergenic
986480587 5:8183080-8183102 CTGGAGAAATGAAGGTCTAAAGG + Intergenic
986753376 5:10811027-10811049 CAGGATAAATGTAGACTTCAAGG + Intergenic
987025995 5:13927136-13927158 GTGGATTAATGTAATTTTAAAGG - Intronic
987500490 5:18702648-18702670 ATGGATAATGGTAGTTTCAATGG - Intergenic
989043964 5:37256447-37256469 CTGGATAACTGAGCTTTTAAAGG + Intergenic
989563178 5:42874306-42874328 CTGGACAAATTTTTTTTTAACGG + Intronic
990689620 5:58348945-58348967 CTGGTTAGATGTAGTGGTAAGGG - Intergenic
991180150 5:63741379-63741401 ATGGATAAATGAAGCTCTAATGG + Intergenic
991621515 5:68550189-68550211 CTGGGTAAATGCAGTCATAAAGG + Intergenic
992476574 5:77108381-77108403 CTGCATTAATATATTTTTAAAGG - Intergenic
993132610 5:83918283-83918305 CAGGGTAAATTTAGTTTTAAAGG - Intergenic
993926155 5:93868907-93868929 CTAGATAAATGGAGTTTTCTTGG - Intronic
996042859 5:118835927-118835949 GTGTATAAATGTAATTTTATGGG - Intergenic
996128159 5:119750284-119750306 CTCAATAAATGTGGTTTGAATGG + Intergenic
996148272 5:120002081-120002103 CTGGATAAATACATTTTTATGGG - Intergenic
997607762 5:135187508-135187530 ATGGAAAAATGTACTTTTAATGG - Intronic
999506671 5:152205596-152205618 CTTGGTAAGAGTAGTTTTAATGG + Intergenic
999642742 5:153688341-153688363 CTGGATAAATGTCATTCTCAAGG - Intronic
999647724 5:153735643-153735665 CTGGACTAATGTAATATTAAGGG - Intronic
999812615 5:155142238-155142260 TTGCATAAATGTAGTTATATAGG - Intergenic
1000291501 5:159875558-159875580 CTGGAAAACTGGAGTTTTAGTGG - Intergenic
1001566090 5:172700437-172700459 CTGGATAAATGAGGGTGTAAAGG + Intergenic
1002937159 6:1683422-1683444 CTGGATGGCTCTAGTTTTAAAGG + Intronic
1003241200 6:4347157-4347179 CTGTCTAAATGTAGTTATCAGGG + Intergenic
1004560084 6:16741299-16741321 CTGGATAACTGTGGTTTTAAAGG + Intronic
1005103837 6:22202013-22202035 CTGGAGATAGGTAGTTTTGATGG + Intergenic
1006667746 6:35708782-35708804 CTGGATAGATGCAGATGTAATGG + Intronic
1008758855 6:54830185-54830207 ATGCTTAAATGGAGTTTTAATGG - Intergenic
1009593071 6:65699811-65699833 CTGTTTTAATATAGTTTTAAGGG - Intronic
1009696103 6:67105448-67105470 TTTGATAAATATAATTTTAATGG + Intergenic
1009803912 6:68577428-68577450 CTGGATAATAGAAGATTTAAAGG - Intergenic
1010267851 6:73886984-73887006 CTGAGTAAATCTAGTTTTTAAGG - Intergenic
1011967672 6:93179350-93179372 CTGTCTAAATATACTTTTAAAGG + Intergenic
1012331238 6:97990682-97990704 TTGGATAAAACAAGTTTTAAAGG + Intergenic
1012744523 6:103068013-103068035 CTGGATAAAAGCAGATTTTATGG + Intergenic
1014214640 6:118741120-118741142 TTTAATAAATGTATTTTTAATGG + Intergenic
1014297533 6:119638407-119638429 CTGGATGAATGTATTATCAATGG + Intergenic
1015412828 6:132913979-132914001 CTGGCTTAATGTACATTTAAGGG + Intergenic
1015913205 6:138188691-138188713 CAGGATAAATGTTGTGTTAAAGG - Intronic
1016715146 6:147217474-147217496 ATAGATAAATATACTTTTAAAGG - Intronic
1018022450 6:159774606-159774628 CCGGCTAAATTTATTTTTAATGG + Intronic
1020572410 7:9882236-9882258 AGGGATAAATTAAGTTTTAAAGG - Intergenic
1022641755 7:32192578-32192600 CTTGATCAATGTAGTTATATAGG + Intronic
1022741992 7:33130508-33130530 CTGGAGAAATGTATTTTTTTGGG + Intronic
1026948343 7:74330702-74330724 CTGGACAAATAATGTTTTAAAGG + Intronic
1027438304 7:78190714-78190736 TTGGAGAAAAGTAGTTCTAAGGG - Intronic
1028274707 7:88840365-88840387 CTGGATAAATATGTTTTAAATGG + Intronic
1028871606 7:95776496-95776518 GTGCATAAATGTAGTTTTCTAGG + Intronic
1029070076 7:97888438-97888460 CTGTATAAATTAAGTTTTACTGG + Intergenic
1029225959 7:99028594-99028616 CAGCAAAAAGGTAGTTTTAAAGG + Exonic
1030616119 7:111739998-111740020 CAAGAAAAATGTAGTTTTTAGGG - Intronic
1031090698 7:117350070-117350092 CTGGACAGAAGTAGTTTTTAAGG - Intergenic
1031107330 7:117561037-117561059 TTGGCTAAATATACTTTTAAAGG - Intronic
1032212197 7:129925901-129925923 CTGGAATAATGTAGTTGTGATGG - Intronic
1032362546 7:131269615-131269637 CTCGATCAATGTATTTTTCACGG + Intronic
1035814110 8:2520239-2520261 TTGGATAAATGTAGTTTATAGGG - Intergenic
1036414373 8:8533381-8533403 CTTTAAAAATGTATTTTTAAAGG + Intergenic
1036595070 8:10204713-10204735 CTGTATATATGTATTTTTAATGG + Intronic
1036706110 8:11048571-11048593 CTGGAGATGTGTATTTTTAAAGG + Intronic
1036885761 8:12551725-12551747 CTGTATAAATTAAGTTTTACTGG + Intergenic
1039931864 8:41999530-41999552 CTGGATAAAAATAGTATTTAAGG - Intronic
1042580402 8:70271340-70271362 CTGACTAAATGTAGCTATAAAGG + Intronic
1042845010 8:73160914-73160936 CTGGAAAAACGTAGTTTCAGCGG - Intergenic
1043206434 8:77449517-77449539 CTGGATAAATGTAAATGTAAAGG - Intergenic
1044761546 8:95522809-95522831 CTATTTAAATGGAGTTTTAATGG - Intergenic
1045847145 8:106650830-106650852 CTTGAGAAAAGTATTTTTAAGGG - Intronic
1047559680 8:125973105-125973127 ATGGATTAATGTCATTTTAAAGG - Intergenic
1047816113 8:128464840-128464862 CTGGATAAATATAATTTCAAGGG - Intergenic
1051461255 9:17318876-17318898 CTGAATAAATGAAGGTTTAATGG - Intronic
1052292648 9:26861163-26861185 GTGATTAAATATAGTTTTAAAGG - Intronic
1053581116 9:39405246-39405268 CTTGCTAAAGGTATTTTTAAGGG + Intergenic
1053593673 9:39537332-39537354 CTATATAAATGTATGTTTAAAGG + Intergenic
1053851455 9:42292377-42292399 CTATATAAATGTATGTTTAAAGG + Intergenic
1054102703 9:60964050-60964072 CTTGCTAAAGGTATTTTTAAGGG + Intergenic
1054572632 9:66827949-66827971 CTATATAAATGTATGTTTAAAGG - Intergenic
1054583659 9:66942816-66942838 CTTGCTAAAGGTATTTTTAAGGG - Intergenic
1055041014 9:71872589-71872611 GTGGAATAATGAAGTTTTAAAGG - Intronic
1057458467 9:95236377-95236399 CTTGAAAAATGTAGTTTTACTGG - Intronic
1058551357 9:106118704-106118726 TTTGACAAATGTATTTTTAAAGG - Intergenic
1058570551 9:106337629-106337651 CTGCACAAATATAATTTTAAAGG + Intergenic
1058775687 9:108281129-108281151 CTGAAAAAAGGTAGGTTTAATGG + Intergenic
1185991813 X:4899736-4899758 GTGGATGAATGTATTTTTTATGG + Intergenic
1186386138 X:9112125-9112147 CTAAATAAATATATTTTTAAAGG + Intronic
1186450095 X:9665037-9665059 CTTGGGAAATGGAGTTTTAATGG + Intronic
1186693682 X:12006449-12006471 CTAAATAAATGTGGTATTAATGG + Intergenic
1189459406 X:41226226-41226248 CTGGATAACCTTAGTTTTTACGG - Intronic
1190972094 X:55359652-55359674 CTGGATTCATGTATTTTTTAAGG - Intergenic
1191766855 X:64706969-64706991 TTGGAGAAAAGTAATTTTAACGG + Intergenic
1191923449 X:66281948-66281970 ATGGATAAATGAATTCTTAAAGG + Intergenic
1192529788 X:71874144-71874166 CTGGATAAATGTATTCCGAAGGG + Intergenic
1192889417 X:75373031-75373053 CTTCATAAATGTAATTTTAATGG - Intronic
1194269261 X:91789999-91790021 TTGGATAACTGTAGTTTGAGGGG - Intronic
1194571459 X:95559030-95559052 CTGCATAAATGTAACTTTAAAGG + Intergenic
1195407409 X:104530911-104530933 CTCTTTAAATATAGTTTTAATGG + Intergenic
1195819371 X:108926793-108926815 GTGGATAAATGTTGTGTTATTGG - Intergenic
1195897780 X:109765041-109765063 ATAAATAAATGAAGTTTTAAAGG + Intergenic
1198318255 X:135491478-135491500 CTGGCTTAATATAATTTTAAAGG + Intergenic
1198413109 X:136391451-136391473 CTTAATAAATGTTGGTTTAAAGG - Intronic
1198517317 X:137422787-137422809 CTGGATTAATGTGGAATTAAAGG - Intergenic
1198852382 X:140978996-140979018 CAGGCTAAGTGTATTTTTAAGGG - Intergenic
1199035278 X:143043100-143043122 CTGGATAAATGAGGCTTTACAGG - Intergenic
1199394658 X:147321196-147321218 TTGAACAAATGTAGTTTTACAGG - Intergenic
1200586479 Y:5010988-5011010 TTGGATAACTGTAGTTTGAGGGG - Intronic
1200949630 Y:8882233-8882255 CAGGATAAATATTATTTTAAAGG - Intergenic