ID: 1093092460

View in Genome Browser
Species Human (GRCh38)
Location 12:14937005-14937027
Sequence CCTTCAGATGGAATTGCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 161}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093092453_1093092460 19 Left 1093092453 12:14936963-14936985 CCATGAACAATAATTAATTGAGG 0: 1
1: 0
2: 0
3: 18
4: 568
Right 1093092460 12:14937005-14937027 CCTTCAGATGGAATTGCTGGAGG 0: 1
1: 0
2: 1
3: 12
4: 161
1093092455_1093092460 -4 Left 1093092455 12:14936986-14937008 CCTCCTCTCTTATTCTGCTCCTT 0: 1
1: 0
2: 2
3: 70
4: 722
Right 1093092460 12:14937005-14937027 CCTTCAGATGGAATTGCTGGAGG 0: 1
1: 0
2: 1
3: 12
4: 161
1093092456_1093092460 -7 Left 1093092456 12:14936989-14937011 CCTCTCTTATTCTGCTCCTTCAG 0: 1
1: 0
2: 0
3: 32
4: 315
Right 1093092460 12:14937005-14937027 CCTTCAGATGGAATTGCTGGAGG 0: 1
1: 0
2: 1
3: 12
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093092460 Original CRISPR CCTTCAGATGGAATTGCTGG AGG Intronic