ID: 1093094284

View in Genome Browser
Species Human (GRCh38)
Location 12:14954597-14954619
Sequence GAGGAAACTCAGATCCGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 450
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 406}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093094284_1093094289 -7 Left 1093094284 12:14954597-14954619 CCACTGCGGATCTGAGTTTCCTC 0: 1
1: 0
2: 2
3: 41
4: 406
Right 1093094289 12:14954613-14954635 TTTCCTCATCTTGGGGGATGAGG 0: 1
1: 0
2: 2
3: 21
4: 292
1093094284_1093094290 -6 Left 1093094284 12:14954597-14954619 CCACTGCGGATCTGAGTTTCCTC 0: 1
1: 0
2: 2
3: 41
4: 406
Right 1093094290 12:14954614-14954636 TTCCTCATCTTGGGGGATGAGGG 0: 1
1: 0
2: 1
3: 12
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093094284 Original CRISPR GAGGAAACTCAGATCCGCAG TGG (reversed) Intronic