ID: 1093094284 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:14954597-14954619 |
| Sequence | GAGGAAACTCAGATCCGCAG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 450 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 41, 4: 406} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1093094284_1093094289 | -7 | Left | 1093094284 | 12:14954597-14954619 | CCACTGCGGATCTGAGTTTCCTC | 0: 1 1: 0 2: 2 3: 41 4: 406 |
||
| Right | 1093094289 | 12:14954613-14954635 | TTTCCTCATCTTGGGGGATGAGG | 0: 1 1: 0 2: 2 3: 21 4: 292 |
||||
| 1093094284_1093094290 | -6 | Left | 1093094284 | 12:14954597-14954619 | CCACTGCGGATCTGAGTTTCCTC | 0: 1 1: 0 2: 2 3: 41 4: 406 |
||
| Right | 1093094290 | 12:14954614-14954636 | TTCCTCATCTTGGGGGATGAGGG | 0: 1 1: 0 2: 1 3: 12 4: 206 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1093094284 | Original CRISPR | GAGGAAACTCAGATCCGCAG TGG (reversed) | Intronic | ||