ID: 1093094594

View in Genome Browser
Species Human (GRCh38)
Location 12:14958234-14958256
Sequence CCTCCATGTCACCAGGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 1, 2: 1, 3: 26, 4: 277}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093094594_1093094599 0 Left 1093094594 12:14958234-14958256 CCCTGTCCCTGGTGACATGGAGG 0: 1
1: 1
2: 1
3: 26
4: 277
Right 1093094599 12:14958257-14958279 AATCCATACTCCCCACTTTGCGG 0: 1
1: 0
2: 0
3: 11
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093094594 Original CRISPR CCTCCATGTCACCAGGGACA GGG (reversed) Intronic
900566906 1:3337788-3337810 GCTCCAGGTCACCAGGGCGAGGG - Intronic
902375791 1:16029369-16029391 GCTCCATGCCACCAGGTGCAGGG - Intronic
902731910 1:18375217-18375239 GCTCCATGTCAGCAGGCACTGGG + Intronic
902796416 1:18803712-18803734 CCTCCCTGTCTCCTGGGCCATGG + Intergenic
902808559 1:18875530-18875552 CCTCCACGGGACCAGGGACCAGG + Intronic
903858557 1:26351739-26351761 CCTGCATACCTCCAGGGACAGGG + Intronic
904043184 1:27595783-27595805 CCTCCCTGACACCAGGAACCTGG - Intronic
904381131 1:30111923-30111945 CCCCCATGTCCCCAGGGCCAAGG + Intergenic
904760177 1:32797517-32797539 CCTGGTTGTCACCAGGCACATGG + Intronic
905277510 1:36828123-36828145 GCTCCATGATACCAGGGACTCGG - Intronic
905357565 1:37395371-37395393 CCTCCACCTCACCAGCCACAGGG + Intergenic
905799466 1:40834112-40834134 CCTCCATGTGCCCAGTGTCAAGG + Intronic
911043438 1:93609677-93609699 CCTCTAGCTCACCAGGGACCTGG + Intronic
911145451 1:94548101-94548123 TCTCCATGGCAGAAGGGACAAGG + Intergenic
911194905 1:94984406-94984428 CCTCCATGTGAACATGGTCAGGG + Intronic
915401501 1:155625220-155625242 TCTCCCTGGCACAAGGGACATGG + Intergenic
915816862 1:158976694-158976716 CTTCAAGGTCACCAAGGACAAGG + Exonic
916331693 1:163624904-163624926 TATACAGGTCACCAGGGACATGG + Intergenic
919384809 1:196907997-196908019 CCTCCATGTCACTTTTGACATGG - Intronic
920450957 1:206060804-206060826 CCTCCATTTCTTCAGGGTCATGG - Intronic
920572042 1:207024709-207024731 CCTCCTTCCCTCCAGGGACAAGG + Intronic
920664456 1:207951368-207951390 CTACCATGTCACCTGGGGCAAGG - Intergenic
920836087 1:209512568-209512590 TCTCCATGTCCCCAGGCCCAGGG + Intergenic
921174574 1:212583001-212583023 CCTTCATCTCTCCAGGGAAAGGG + Intronic
922095543 1:222440102-222440124 CATCCATCTCACCAGGGAATGGG + Intergenic
922468618 1:225861876-225861898 CCTCCATCTCCCCTGGGGCAAGG + Intronic
922483844 1:225958152-225958174 CTGCCATGTCAACAGGGTCAGGG + Intergenic
922853010 1:228750150-228750172 CCTCCATGTCACCAGCCACATGG + Intergenic
1062861842 10:816335-816357 GCTCCATGTCAACAGGGGAAGGG + Intronic
1064208295 10:13343372-13343394 CCTGCAGGTCACCAGCGACTGGG + Intronic
1064389900 10:14933113-14933135 CCAGCATGTCAACAGGCACAAGG + Intronic
1064400333 10:15015630-15015652 CCAGCATGTCAACAGGCACAAGG + Intergenic
1067012869 10:42730868-42730890 CCACCAGGTCACCATGCACATGG + Intergenic
1067533558 10:47092036-47092058 CCTCTGTGGAACCAGGGACATGG + Intergenic
1067775783 10:49163999-49164021 CTTCCATGGGACCAGGGACTGGG - Intronic
1069743537 10:70700462-70700484 CCTCTCTGCCACCAGAGACAAGG - Intronic
1070190979 10:74111980-74112002 CTTCCATGTCAGGGGGGACAGGG - Exonic
1071523801 10:86346780-86346802 CCTCCAGGTTCCAAGGGACAAGG - Intronic
1072443067 10:95474294-95474316 CCTCCATGCCACCAAAGAAACGG + Intronic
1076646268 10:131957169-131957191 CCTCCATCTCCACAGGGGCACGG - Intronic
1076646460 10:131957981-131958003 CCTCCATGTCCACAGGGGCACGG - Intronic
1076794805 10:132793316-132793338 CCTGCATGGCCCCTGGGACAAGG + Intergenic
1076809977 10:132881420-132881442 CCTCCTTTCCAGCAGGGACATGG - Intronic
1077031567 11:470381-470403 CATCCAGGTCATCAGAGACAAGG + Intronic
1077253723 11:1571722-1571744 CGTCCAGGACGCCAGGGACAGGG - Intronic
1077263541 11:1636675-1636697 CCTCCAGGTCACCACCAACAAGG + Intergenic
1077305451 11:1866844-1866866 CCCCCTTGTCACCAGGGGCTCGG + Exonic
1081326769 11:41754590-41754612 CATACAGGTCACCAGGGAAATGG + Intergenic
1082935046 11:58647385-58647407 CATACAGGTCACCAGGGAAATGG + Intronic
1083726358 11:64630566-64630588 CCTCCATGTCCCCAGGACCAGGG - Exonic
1085039225 11:73317261-73317283 CGTGCATGTCTCCTGGGACAGGG + Intronic
1085179467 11:74521380-74521402 GCTCTATTTCACCAAGGACAAGG + Intronic
1085840930 11:80011225-80011247 ACTCCATGACAACAGGTACAGGG + Intergenic
1087902006 11:103651434-103651456 CATCCAGGTCACCAGGGAAGAGG - Intergenic
1088828505 11:113515728-113515750 ACTCCATCTCTTCAGGGACAAGG + Intergenic
1090534337 11:127624302-127624324 CCTCCAGGTCACCAAGGAGAGGG - Intergenic
1093094594 12:14958234-14958256 CCTCCATGTCACCAGGGACAGGG - Intronic
1096114054 12:49044783-49044805 CCTTCTTGTCATCAGGGCCAAGG + Exonic
1096684274 12:53277493-53277515 CCTCCAAGTTACCAGGGGCCTGG - Exonic
1097290382 12:57909399-57909421 CCTCCTTGGCACCACAGACAAGG - Intergenic
1100288493 12:93190551-93190573 CCTCCCTGTCATAAGGGTCATGG - Intergenic
1101616402 12:106342241-106342263 ATTCCATGTCCCCAGGGATAAGG - Intronic
1101914663 12:108886884-108886906 CCTCAATGTCACCATTCACATGG + Intronic
1102299224 12:111758854-111758876 CCTGCAAGTAACCTGGGACAGGG + Intronic
1102552262 12:113700059-113700081 CCTACATGTCATGAGGGACCTGG + Intergenic
1102594842 12:113984316-113984338 CCTCCTTGTCCCAAGGGTCAAGG - Intergenic
1103099159 12:118157272-118157294 TCTCCATGTCACCAGAGTGATGG + Intronic
1103294879 12:119877404-119877426 CCTCCATGCCTTTAGGGACATGG - Intergenic
1103680297 12:122688615-122688637 CCTCTGTGTCTTCAGGGACAAGG - Intergenic
1105615983 13:22012858-22012880 CTTCCATGTCACCAGGAAGTGGG - Intergenic
1106045221 13:26133437-26133459 CCTTCATGTCACCAGAGTCCTGG - Intronic
1112543394 13:100339739-100339761 TCTCCTTTTCTCCAGGGACAGGG + Intronic
1112954816 13:105043965-105043987 CACCTATGTCCCCAGGGACAGGG + Intergenic
1113422594 13:110182051-110182073 ACTCCATGTCACATGGGTCACGG + Intronic
1114496583 14:23137178-23137200 CCTCCATGCATCCAGGGACCCGG - Intronic
1121045530 14:90784982-90785004 CCTCCATTGCAGCAGGGCCAAGG + Intronic
1121340152 14:93100212-93100234 GCTCCAGGTCCACAGGGACAGGG - Intronic
1121432189 14:93895437-93895459 CCTGCATACCTCCAGGGACAAGG + Intergenic
1122774192 14:104110043-104110065 GCGCCAAGTCACCAGGCACAAGG - Intronic
1123047321 14:105525447-105525469 CCACCATCTCTCCAGCGACAGGG + Intergenic
1125904316 15:43376509-43376531 CATCCATCTCAACAGGGCCAAGG + Exonic
1126683498 15:51226563-51226585 CCCCCATCTCAGCAGGCACATGG + Intronic
1127496005 15:59512797-59512819 CTTCCCAGTCACCTGGGACAGGG + Intronic
1129434738 15:75529562-75529584 CTACCATGTGACCATGGACACGG + Intronic
1131702738 15:94957118-94957140 GCTCCATGCAACCAGGGTCATGG - Intergenic
1131797440 15:96034141-96034163 CCTGCATGTCCCCAGACACAAGG - Intergenic
1131902115 15:97099245-97099267 CCTCCATAGCACCATGGACAGGG + Intergenic
1132415048 15:101613601-101613623 ACTCCAGGTCACCGGGGAAAGGG + Intergenic
1132892344 16:2210492-2210514 CCTCCTCAGCACCAGGGACATGG - Intronic
1133575142 16:7081753-7081775 CATCCATGTTACCAAGGCCAGGG - Intronic
1134007458 16:10827810-10827832 ACACCCTGTCACCAGGGACGTGG + Intergenic
1134038658 16:11051203-11051225 TCTCCACCTCAGCAGGGACAGGG - Intronic
1134241132 16:12507869-12507891 CCAGCATGGCACCAGGCACACGG + Intronic
1134504082 16:14791150-14791172 CCTCCGTGTGACCTGGGGCAAGG + Intronic
1134576490 16:15337758-15337780 CCTCCGTGTGACCTGGGGCAAGG - Intergenic
1134725953 16:16418741-16418763 CCTCCGTGTGACCTGGGGCAAGG + Intergenic
1134941481 16:18293118-18293140 CCTCCATGTGACCTGGGGCAAGG - Intergenic
1137018888 16:35402905-35402927 CCTCCATGACAGAAGGGACAAGG - Intergenic
1137621787 16:49881120-49881142 CCTCCTTGTCATCTGGGACTCGG + Intergenic
1137760273 16:50934821-50934843 GCTCCATGTCTCCAGGGCCATGG - Intergenic
1138560283 16:57797263-57797285 CCTGTAGGTCACGAGGGACAGGG + Intronic
1138963171 16:62051599-62051621 CCTGCATTTCACCATGGACCTGG - Intergenic
1139655816 16:68386798-68386820 CCTCCACGTCGCCAGGGCGAGGG + Intronic
1141946019 16:87310721-87310743 CCTCCATGCAGCCAGGGCCAGGG + Intronic
1142238442 16:88934229-88934251 CCTCCATGTGCCGAGGGGCATGG - Intronic
1142772230 17:2106761-2106783 CTTTCCTGTCAGCAGGGACACGG - Intronic
1144074044 17:11701139-11701161 CCTTCATGTGACCAAGGACATGG - Exonic
1148553584 17:48564707-48564729 CTTCAATGTCACCAGCGAAATGG + Intronic
1150714207 17:67557567-67557589 TCCCCTTGTCACCAGGGAGATGG - Intronic
1151480707 17:74368783-74368805 GGTCCATTTCACCAGGGCCAGGG + Intronic
1152160436 17:78665133-78665155 TGTCCAAGGCACCAGGGACAAGG + Intergenic
1152728466 17:81958988-81959010 CCTCTGTGTCCCCAGGCACAGGG - Exonic
1152797834 17:82316662-82316684 CCTACCTGTCACCAGGACCAGGG + Exonic
1153730888 18:8010648-8010670 CCTCCATCTCACCAAGTCCATGG - Intronic
1153839630 18:8994721-8994743 CATGGATGTCACCTGGGACATGG - Intergenic
1156457621 18:37303656-37303678 TCTCCAGGTCCCCAGGAACAGGG + Intronic
1157549769 18:48573370-48573392 CCTCCATGTGACCCAGGCCAGGG + Intronic
1158038835 18:53068646-53068668 CCTCCCTGTGAGCAGGTACAGGG - Intronic
1158478019 18:57797635-57797657 CCTCCATGCAAAGAGGGACAAGG + Intronic
1159911802 18:74152622-74152644 CCCCCCTACCACCAGGGACAGGG + Intronic
1159959209 18:74542204-74542226 TCACCCTGTCAGCAGGGACAAGG - Intronic
1160622627 18:80181416-80181438 CACCCAGGTCACCAGGGACACGG + Intronic
1160699365 19:498530-498552 CCTCCGGGTCACCAGGCACCAGG - Exonic
1160905951 19:1451851-1451873 CCCAAATGTCACCAGGGGCACGG - Exonic
1162069611 19:8145931-8145953 CCTTCCTGTCCCCAGGGTCAGGG - Exonic
1162097892 19:8321649-8321671 CCTCCAGGTCACCAAGGTCCTGG + Exonic
1163369158 19:16892464-16892486 TGTCAATGTCACCAGGGATAAGG + Exonic
1164574283 19:29396625-29396647 CCTCCTCCTCCCCAGGGACAGGG + Intergenic
1164865060 19:31597881-31597903 CTCCCATGTCACCAGGGGCGAGG + Intergenic
1165148279 19:33745940-33745962 CCTCCATTCCACATGGGACAAGG + Intronic
1166061134 19:40326412-40326434 CCTCCATCTCAGCAGTGACCCGG + Exonic
1167128459 19:47568236-47568258 CATCCATGTTACCAGGGAAAGGG + Intergenic
1167477745 19:49710707-49710729 CCTCCCTGTCCCCCAGGACAGGG + Exonic
1168169008 19:54574140-54574162 CCTCCTCCTCACTAGGGACAAGG + Intronic
1168173694 19:54607934-54607956 CCTCCTCCTCACCGGGGACAGGG + Intronic
1168269142 19:55240198-55240220 CCTTCATGTCTCCAGGGGCTGGG - Intronic
928209873 2:29315572-29315594 CCTCCAAATCACCAAGGATAGGG + Intronic
929770623 2:44888627-44888649 GCCCAATGTCACCAGGGAGATGG - Intergenic
929959282 2:46484324-46484346 CATCTATGTCACCAAGGAGATGG + Exonic
932404129 2:71502717-71502739 CCTTCCTGTCTTCAGGGACAGGG - Intronic
933242269 2:79935271-79935293 CCTCCATGTGACTTTGGACAAGG - Intronic
937333668 2:121047459-121047481 CCACCTTGTCACCAGGGACCGGG + Intergenic
938316718 2:130334440-130334462 CCTTTTTGGCACCAGGGACAGGG - Intergenic
938662959 2:133506170-133506192 GTTCCATGTAACCAGTGACATGG - Intronic
938938487 2:136148177-136148199 CTTCCATGTTACCAGCTACATGG - Intergenic
939739300 2:145886120-145886142 CCTCCAAGTCACCAGGTAAAAGG + Intergenic
940231649 2:151460626-151460648 CTTTCATTTCACCAGGGCCATGG - Intronic
943185388 2:184599473-184599495 CCTCCTTGTGACCAGCCACATGG - Intronic
944702911 2:202261550-202261572 CCTTCTTGTTACCAGGCACATGG + Intergenic
948484421 2:238271475-238271497 CTTCCCAGACACCAGGGACACGG + Exonic
948681934 2:239640989-239641011 ACTCCATCTCTCCAGGGTCAGGG + Intergenic
948909877 2:240997815-240997837 CCTCTATGTCCCCAGGCCCATGG - Intergenic
1168815544 20:734173-734195 ACACCCTGTCCCCAGGGACAAGG - Intergenic
1168879523 20:1194662-1194684 CCACCATCTCACCAGGGTCAAGG + Intergenic
1170777914 20:19394611-19394633 GCTCCATGTCACCAGTCACTAGG + Intronic
1172391361 20:34567538-34567560 CATCCAGGGCACCAGGGACGAGG - Intronic
1172935722 20:38618704-38618726 CCTGCATGTCACCTGGCACTTGG + Intronic
1173325732 20:42031672-42031694 TCTCCATGTGACCTTGGACAGGG + Intergenic
1173457461 20:43215173-43215195 CCTACAAGTCACCAGGCATACGG + Intergenic
1173949553 20:46979287-46979309 CTTCCCAGTCCCCAGGGACAGGG + Intronic
1174238873 20:49116874-49116896 CCTCCAGGCCAGCAGGGAAAAGG + Intronic
1176055524 20:63144476-63144498 CCTCCGTGTCACGAAGGGCATGG - Intergenic
1179130700 21:38634422-38634444 CCTGCATATTCCCAGGGACAGGG - Intronic
1179632705 21:42688577-42688599 TCCCCAGGTCACCAGGAACAGGG - Intronic
1179830278 21:43992215-43992237 CCTCCATGACAAGAGGCACATGG - Intergenic
1179949842 21:44703438-44703460 CCTCAAACTCACCAGGGACAGGG - Intronic
1180041534 21:45282827-45282849 CCTCCATGTGTCCAGTGCCAGGG - Intronic
1180840323 22:18956063-18956085 CATCCATGTCCCCTCGGACATGG - Intergenic
1180998030 22:19975158-19975180 CCTGCATGTCACCAGGGTGGAGG - Intronic
1181061165 22:20282713-20282735 CATCCATGTCCCCTTGGACATGG + Intronic
1181712123 22:24697247-24697269 CCTTCCTGTCACAAGGGCCATGG - Intergenic
1183011795 22:34952727-34952749 CCTCAAAGTCACCAGGGCCTTGG + Intergenic
1183457999 22:37933148-37933170 CCTCCGTGTCACCAGGCCCCAGG - Intronic
1184008583 22:41729533-41729555 CCCACATGGCACCAGGCACAAGG - Intronic
1184369825 22:44075181-44075203 CATCCATGTCTCCAGGGCCCAGG - Intronic
1185316750 22:50182630-50182652 CTTCAATGTGACCAGGGCCATGG + Intergenic
950316163 3:12004078-12004100 CCTCCATTTCAGCTGGGACACGG + Intergenic
951043814 3:18016245-18016267 CCCCCAAGTGAGCAGGGACAGGG + Intronic
953608476 3:44427915-44427937 CCTCGATGTCACAAAGGTCAGGG + Intergenic
954452027 3:50576907-50576929 CCTTCATGTCAGCTGGGGCATGG - Intronic
954661558 3:52229421-52229443 CCTCCCTGTCTCCAGGCCCAGGG + Intronic
956637687 3:71382475-71382497 CCTCCCTGTGGCCAGGGAGATGG - Intronic
958443418 3:94184462-94184484 CCTCCATCTCAACATGGGCAAGG + Intergenic
959935900 3:112027855-112027877 CCTGCAAGTCATCAGGGAAAGGG + Intergenic
961473936 3:127135498-127135520 CCGCGCTGTCACCAGGGCCACGG + Intergenic
961529060 3:127528766-127528788 CCTCCATGTCATCTAGGCCAGGG - Intergenic
961682265 3:128607375-128607397 CCTCCCTGACATCAGGGAGATGG - Intergenic
962279477 3:134039259-134039281 CCTCCCTGTGACCATGAACAGGG - Intronic
963305190 3:143643799-143643821 CATCCCTGTGACCAGTGACATGG - Intronic
964227433 3:154423121-154423143 CCTCCATGTCACAAGGGACAAGG + Intronic
966417323 3:179702563-179702585 TTTCCATGTCACTAGGGACTCGG + Intronic
966646599 3:182252504-182252526 CCTCCACCTCTCCAGGGACCAGG - Intergenic
966777300 3:183554163-183554185 TCTCCATATCAGCATGGACATGG - Intronic
967016222 3:185484252-185484274 CCTGCCTGTCTCCAGGGTCATGG + Exonic
968731906 4:2273107-2273129 CCTCCCTGTGGGCAGGGACACGG + Intronic
968792024 4:2671816-2671838 CCCACATGTGAGCAGGGACAAGG - Intronic
969455720 4:7298658-7298680 CCTCCATGACACCAGCGGCATGG - Intronic
969712706 4:8853262-8853284 GCCCCAGGTCACCAGGGACCTGG + Intronic
969763586 4:9210641-9210663 CCTCCATGTCGACTGGAACAAGG - Exonic
969764188 4:9215389-9215411 CCTCCATGTCGACTGGAACAAGG - Exonic
969764794 4:9220136-9220158 CCTCCATGTCGACTGGAACAAGG - Exonic
969765402 4:9224880-9224902 CCTCCATGTCGACTGGAACAAGG - Exonic
969766015 4:9229625-9229647 CCTCCATGTCGACTGGAACAAGG - Intergenic
969767239 4:9239114-9239136 CCTCCATGTCGACTGGAACAAGG - Intronic
969767843 4:9243863-9243885 CCTCCATGTCGACTGGAACAAGG - Exonic
969768445 4:9248614-9248636 CCTCCATGTCGACTGGAACAAGG - Exonic
969769052 4:9253362-9253384 CCTCCATGTCGACTGGAACAAGG - Exonic
969770271 4:9262856-9262878 CCTCCATGTCGACTGGAACAAGG - Exonic
970102652 4:12542724-12542746 CCTCCATGTCACAGGGAAAATGG - Intergenic
970709612 4:18846533-18846555 ACTCCATCTCTCCAGGGAAATGG - Intergenic
971257053 4:25024182-25024204 CCTGCTTGGCACCAGGCACAGGG - Intronic
971373969 4:26041347-26041369 CCACCATGTCAACAGCGCCAGGG + Intergenic
975392159 4:73833094-73833116 CCCCAGTGTCACAAGGGACAAGG + Intergenic
977233907 4:94484033-94484055 CCTGCATGTCTCCAGAAACAAGG + Intronic
978824983 4:113011638-113011660 CATCCTTGTCACCAGAGACAGGG - Intronic
981564215 4:146081237-146081259 CATCCCAGTCACCAGGGACCTGG - Intergenic
982138879 4:152298594-152298616 CCACAATGTCACCACGGACCTGG + Intergenic
982449950 4:155541703-155541725 CCTCGATGTCCCCTGGGAAATGG + Intergenic
983881481 4:172938201-172938223 GCTGGATGTCACCAGGGAGATGG - Intronic
985421383 4:189788367-189788389 CCTACATGTCACACGTGACAAGG + Intergenic
985604249 5:850020-850042 CCTCCTTGGCACCAGGGGCAAGG + Intronic
987451057 5:18084561-18084583 ACTCCATGTCACCAAGTAAATGG - Intergenic
988126726 5:27049128-27049150 CCTCCATGCCTCCAGGGAGAAGG - Intronic
991141240 5:63246017-63246039 CCTGCATATCACCTGGGAAATGG + Intergenic
992326507 5:75665381-75665403 CCTAAATGTCACAAGGGAAAGGG - Intronic
992748289 5:79839806-79839828 CCACCATGTTTCCAGGGACCTGG + Intergenic
994965812 5:106669490-106669512 CATCAATGTCACCAGAGCCAAGG - Intergenic
995669952 5:114591665-114591687 CATCCATGTTGCCAGGGCCAGGG - Intergenic
996130012 5:119770216-119770238 TCTCCAAGTCAGGAGGGACAGGG - Intergenic
999237504 5:150107880-150107902 CCACCATGTCCCCAGGGCCAGGG - Intronic
1000308381 5:160017384-160017406 CCTACATGGCAGCAGGGGCAGGG + Intronic
1001656146 5:173351863-173351885 GCAAAATGTCACCAGGGACATGG - Intergenic
1002575660 5:180172407-180172429 CCTGCATGTGACCAGGGCCCAGG + Intronic
1003128376 6:3374290-3374312 CCTCCCTGGCACCATGCACATGG + Intronic
1003561542 6:7184789-7184811 CCTCCAAGTGACCAGCCACAGGG - Intronic
1003644972 6:7907424-7907446 CCTCACTGTCACCAGGTTCAGGG + Intronic
1006467903 6:34206956-34206978 CCAGCATGTCTCCAGGCACAGGG + Intergenic
1007345763 6:41228480-41228502 CCTCCATGTCACCTGAGGCCAGG - Exonic
1010689985 6:78899031-78899053 CCCCCATGGGACCTGGGACAAGG - Exonic
1014126029 6:117778007-117778029 CCCCCAGGGCACCAGAGACATGG - Intergenic
1014769893 6:125448733-125448755 CCTTCAAGTCGACAGGGACAGGG - Intergenic
1015513721 6:134064286-134064308 CCTGCATTGCACCAGGCACATGG - Intergenic
1016032705 6:139354470-139354492 CCTCCACCTCACAAGGGACCTGG + Intergenic
1018096826 6:160394836-160394858 CCCCCATGTGGCCAGGCACACGG + Intronic
1019290837 7:249278-249300 CCTCAAGGGCACCAGGGACCAGG - Intronic
1019481870 7:1270622-1270644 CCTCCACCTCACCTGGGAAAAGG - Intergenic
1019712460 7:2523899-2523921 CCTGCAGGTCACCCAGGACAGGG + Intronic
1019720532 7:2567872-2567894 CCTCCATGTCACAGAGGGCAGGG + Intronic
1019822779 7:3257932-3257954 CCACAAAGTCACCAGGGACCTGG + Intergenic
1022106728 7:27202063-27202085 CCTTCAAGTCCCCAGGAACAGGG - Intergenic
1023684935 7:42724103-42724125 TCTCCATGGCAGCAGGCACAAGG + Intergenic
1024746343 7:52411038-52411060 GCTCCATGTAAACAGGCACAGGG - Intergenic
1025638837 7:63349205-63349227 CCTGGATGTGACCAGGGATAAGG - Intergenic
1025643859 7:63398884-63398906 CCTGGATGTGACCAGGGATAAGG + Intergenic
1026145929 7:67746773-67746795 CTGCCATGTTACAAGGGACACGG - Intergenic
1026991756 7:74590033-74590055 CAGCCATGTCACCAGGGAGCAGG - Intronic
1027184609 7:75963429-75963451 CCCCCATCTCATCAGGGACCAGG - Intronic
1028471007 7:91206309-91206331 CCTTCATGTCTCCAGCTACAGGG - Intronic
1030869710 7:114740276-114740298 CCTTCATATCACAAAGGACATGG - Intergenic
1033816740 7:145082884-145082906 CATACATGTCACCAGGGAAGTGG + Intergenic
1034719949 7:153282403-153282425 GCTCCATGTCATCAGGGAAATGG - Intergenic
1036215642 8:6877697-6877719 CCTCCGTGTCCCAAGGGACGAGG - Intronic
1036274855 8:7341810-7341832 CCTCCATGTCGCCTGGAACAAGG - Intergenic
1036346499 8:7968538-7968560 CCTCCATGTCGCCTGGAACAAGG + Intergenic
1036347040 8:7973247-7973269 CCTCCATGTCGCCCGCAACAAGG + Intergenic
1036687838 8:10923694-10923716 CCTCCGTGTCACCACGTTCATGG - Intronic
1036841821 8:12129291-12129313 CCTCCATGTCGCCCGCAACAAGG + Intergenic
1036842925 8:12138754-12138776 CCTCCATGTCGCCCGCAACAAGG + Exonic
1036863639 8:12375540-12375562 CCTCCATGTCGCCCGGAACAAGG + Intergenic
1036864205 8:12380258-12380280 CCTCCATGTCGCCCGGAACAAGG + Intergenic
1036935528 8:12998641-12998663 GCTCCTTGTCACCAGGGAGGAGG - Intronic
1039429488 8:37514740-37514762 CCACCAAGTCACCAGCGACCCGG - Intergenic
1041657185 8:60364997-60365019 CATCCATGGCACCAAGGAAATGG + Intergenic
1042796226 8:72665974-72665996 TCCCCATGTCCCCTGGGACAGGG + Intronic
1047190486 8:122674716-122674738 CCTCCATGAGGCAAGGGACATGG - Intergenic
1048331938 8:133476532-133476554 CCATCCTGTCGCCAGGGACATGG + Exonic
1048582013 8:135737066-135737088 CATCCATGTTACCAGGGAGGAGG - Intergenic
1049295474 8:141832008-141832030 ACTCCGTGTCACCAGGCACCAGG - Intergenic
1049970414 9:817338-817360 CCTCGATGTCCCCAGGGTCCAGG - Intergenic
1050152503 9:2630673-2630695 CCTCCATGTCAACCGCTACAGGG + Intronic
1050335843 9:4589382-4589404 CCTTCATCACATCAGGGACACGG - Intronic
1053544014 9:39003964-39003986 CCCCCAAGTCACCATGCACAGGG + Intergenic
1053808448 9:41827461-41827483 CCCCCAAGTCACCATGCACAGGG + Intergenic
1054622144 9:67359967-67359989 CCCCCAAGTCACCATGCACAGGG - Intergenic
1055187138 9:73470795-73470817 CATGCAGGTCACCAGGGAAATGG + Intergenic
1056551686 9:87658180-87658202 CCTCCAGGGCAGGAGGGACAGGG + Intronic
1057878722 9:98777157-98777179 CCTCCATGAGAACAGGGCCAGGG + Intronic
1058389476 9:104478425-104478447 CCTCCATGCCCCAGGGGACAGGG + Intergenic
1058633017 9:107008744-107008766 CCTCCATGGTACTAGGCACATGG - Intronic
1060547051 9:124467986-124468008 CCTCCATCTGCCCAGGCACAGGG + Intronic
1061059066 9:128241445-128241467 GCTCCAGGTCCCCAGGGGCAAGG - Intronic
1062512675 9:136915952-136915974 CTGCCATGTCACCTGGGAAATGG + Intronic
1062550463 9:137083772-137083794 TCTTCATGTCAGCAGGGAGAGGG - Exonic
1203784982 EBV:122616-122638 CCACCATTTTACCAGGGACGAGG - Intergenic
1186211667 X:7256475-7256497 TCTACATGCCCCCAGGGACAGGG - Intronic
1187479323 X:19640600-19640622 CCTCAAGACCACCAGGGACAAGG - Intronic
1187833215 X:23404097-23404119 CCCCCAAGTCACCTGGGAAATGG + Exonic
1191895172 X:65985079-65985101 CCCCCATGTCATCTGGAACAGGG - Intergenic
1191921350 X:66260213-66260235 TCTCCATGCCAGCATGGACATGG - Exonic
1192716383 X:73647202-73647224 AATCCATGCCACCAGGGACTAGG + Intronic
1193771521 X:85593297-85593319 CTTACAGGTCACCAGGGAAATGG - Intergenic
1194510107 X:94783347-94783369 CATACATGTCACCAGGGAAGTGG - Intergenic
1195701386 X:107708288-107708310 CTTCCATGTCACCAGAGGCTGGG + Intergenic
1196760174 X:119193840-119193862 ACTGCCTGTCACCAGGGAAATGG - Intergenic
1199190342 X:144963130-144963152 CTTCCATCTCACCAGGAAGACGG + Intergenic
1200066846 X:153508037-153508059 ACTGGATGTGACCAGGGACAAGG - Intronic