ID: 1093095760

View in Genome Browser
Species Human (GRCh38)
Location 12:14970511-14970533
Sequence GGTATCAAAGAAGCCCAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 5, 3: 30, 4: 188}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093095760_1093095766 -2 Left 1093095760 12:14970511-14970533 CCCACTTGGGCTTCTTTGATACC 0: 1
1: 0
2: 5
3: 30
4: 188
Right 1093095766 12:14970532-14970554 CCGCTCTGGTAGGGAGAAGAAGG 0: 1
1: 0
2: 1
3: 12
4: 152
1093095760_1093095768 16 Left 1093095760 12:14970511-14970533 CCCACTTGGGCTTCTTTGATACC 0: 1
1: 0
2: 5
3: 30
4: 188
Right 1093095768 12:14970550-14970572 GAAGGTGGCCTCGTTATGACTGG 0: 1
1: 0
2: 0
3: 8
4: 93
1093095760_1093095770 23 Left 1093095760 12:14970511-14970533 CCCACTTGGGCTTCTTTGATACC 0: 1
1: 0
2: 5
3: 30
4: 188
Right 1093095770 12:14970557-14970579 GCCTCGTTATGACTGGTTGGAGG 0: 1
1: 0
2: 0
3: 4
4: 43
1093095760_1093095767 1 Left 1093095760 12:14970511-14970533 CCCACTTGGGCTTCTTTGATACC 0: 1
1: 0
2: 5
3: 30
4: 188
Right 1093095767 12:14970535-14970557 CTCTGGTAGGGAGAAGAAGGTGG 0: 1
1: 0
2: 4
3: 53
4: 918
1093095760_1093095769 20 Left 1093095760 12:14970511-14970533 CCCACTTGGGCTTCTTTGATACC 0: 1
1: 0
2: 5
3: 30
4: 188
Right 1093095769 12:14970554-14970576 GTGGCCTCGTTATGACTGGTTGG 0: 1
1: 0
2: 0
3: 4
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093095760 Original CRISPR GGTATCAAAGAAGCCCAAGT GGG (reversed) Intergenic
900398924 1:2464972-2464994 GGTGTCACTGAAGCCCAAGAGGG + Intronic
902803187 1:18843883-18843905 GGTATCCAAGAAGCGCCAGTGGG + Intronic
903180261 1:21601733-21601755 CGTCTCACAGGAGCCCAAGTCGG - Exonic
906013626 1:42552958-42552980 GGTGTCAGAGAAGGCCAAGTAGG - Intronic
908185500 1:61649034-61649056 GGAATCCAATAAGCCTAAGTAGG + Intergenic
908290086 1:62656964-62656986 AGTATCAGAGAAGCACAAGTAGG + Intronic
909048335 1:70737434-70737456 GGTGTCAAAGAGGACCAAGTAGG - Intergenic
909260132 1:73477343-73477365 GGGCTCAAAGAACTCCAAGTAGG + Intergenic
911390316 1:97233248-97233270 GGTGTCAGTGAAGGCCAAGTAGG - Intronic
911658735 1:100475905-100475927 AGTGTCAAAGAAGGCTAAGTTGG - Intronic
911923968 1:103803274-103803296 GATATCAGAGAAGGCCAAATAGG + Intergenic
914394337 1:147250600-147250622 GGTATAAGAGAAGGCCAAGTAGG - Intronic
914906430 1:151749760-151749782 GGTGTCACACAAGGCCAAGTAGG - Intergenic
915712612 1:157915873-157915895 GGTGTCAGAGAAGCCTGAGTAGG - Intergenic
918128429 1:181604418-181604440 CGTTTCAGAGAAGCCCAGGTTGG + Intronic
918413718 1:184286502-184286524 TGTATCCAAGAAGCCCAATAAGG + Intergenic
918885172 1:190183770-190183792 GGTATGATAGAAAGCCAAGTGGG - Intronic
921281326 1:213570867-213570889 GGAATAAAAGAAGTCCAATTTGG - Intergenic
921972476 1:221165306-221165328 GTTTTCAATGAAGCCCATGTAGG + Intergenic
922918814 1:229283307-229283329 GGTGTCAGAGAAGACCAAGTAGG - Intronic
1063281744 10:4637351-4637373 GGAATCATAGAAGCTGAAGTGGG - Intergenic
1067246415 10:44550389-44550411 GGTATCAGAGAATGCCCAGTGGG - Intergenic
1067709914 10:48640376-48640398 TATCTCAAAGAATCCCAAGTAGG + Intronic
1067912814 10:50363987-50364009 GGTATCAAAAAAGAACAAGATGG + Intronic
1068625496 10:59242128-59242150 GGTATCAGAGAAGCCTGAATAGG + Intronic
1069440430 10:68423666-68423688 GGTGTCAGAGAAAGCCAAGTAGG + Intronic
1069964943 10:72106930-72106952 TGTACCAAAGAATGCCAAGTGGG + Intronic
1070097521 10:73352245-73352267 GATGTCAGAGAAGACCAAGTAGG - Intronic
1070292034 10:75123467-75123489 GGTATCAGAGAAGACCAAGTAGG - Intronic
1070394818 10:76002892-76002914 GGAATGAAAGATCCCCAAGTTGG + Intronic
1075716952 10:124561326-124561348 GGTGTCAGAGAAGGCCAAGGAGG + Intronic
1078769583 11:14336049-14336071 GGTGTCAGGGAAGACCAAGTGGG + Intronic
1080452507 11:32390232-32390254 GTTCTCAGAGAAGGCCAAGTGGG - Intronic
1080622231 11:33996449-33996471 GGCAACAAACAAGTCCAAGTGGG + Intergenic
1080876723 11:36281438-36281460 GGTGTCAGAGAAGGCCAAGTAGG + Intronic
1081008079 11:37773634-37773656 GGAGTCAAAGAAGACCATGTGGG - Intergenic
1086960251 11:92973671-92973693 GGTATCTTAGAAGCCCAACAAGG - Intronic
1090223999 11:125057802-125057824 GGTGTCAGAGAACTCCAAGTGGG - Intergenic
1090592350 11:128285776-128285798 TGTATGAAAGCTGCCCAAGTTGG - Intergenic
1091199386 11:133762369-133762391 GGTATCAGGAAAGGCCAAGTAGG + Intergenic
1093095760 12:14970511-14970533 GGTATCAAAGAAGCCCAAGTGGG - Intergenic
1093237879 12:16634186-16634208 TGTATGAGAGAAGCCCAGGTAGG + Intergenic
1094206367 12:27844633-27844655 GGAAGCCAAGAAGCCCAATTTGG - Intergenic
1094395984 12:30006378-30006400 GGTATCAGAGAAGGCCAAATAGG + Intergenic
1095799730 12:46259258-46259280 AGGATCCAAGAACCCCAAGTGGG - Intronic
1096712232 12:53465747-53465769 GGGTTCAAAGAAGGCCAATTTGG + Intronic
1098731462 12:74040691-74040713 GGTAGCAGGGAAGACCAAGTGGG + Intergenic
1098897062 12:76075705-76075727 GACATCAAAGAAATCCAAGTAGG + Intronic
1099865328 12:88272839-88272861 GGTGTCAGAGAAGACTAAGTGGG + Intergenic
1100629763 12:96375869-96375891 GGTGTCAGACATGCCCAAGTAGG - Intronic
1102476494 12:113191908-113191930 GGTATTAAAGAAGCCCCTGTGGG + Exonic
1102776051 12:115519941-115519963 GGCATCAAAGAATGACAAGTAGG - Intergenic
1103997434 12:124839538-124839560 GGTATCAAAGAAATGGAAGTGGG - Intronic
1104203543 12:126615076-126615098 GGTATCAAGGCACCCCAAGTTGG - Intergenic
1104327615 12:127814499-127814521 TCTTTGAAAGAAGCCCAAGTGGG + Intergenic
1105462549 13:20606121-20606143 GGTGTCAGAAAAGGCCAAGTGGG + Intronic
1107446746 13:40476137-40476159 GATATTAAAAAAGGCCAAGTGGG - Intergenic
1107756451 13:43628818-43628840 GGTGTCAGCGAAGGCCAAGTGGG - Intronic
1111724866 13:91994366-91994388 GGCATCAAAGAAGCCTGTGTTGG + Intronic
1112392043 13:98994224-98994246 GTGCTCAAACAAGCCCAAGTGGG - Intronic
1114956848 14:27831909-27831931 GATATCAGAGAAGGCCATGTGGG - Intergenic
1116440784 14:44950304-44950326 GGTATCAGAGAAGACAGAGTGGG - Intronic
1116766375 14:49075602-49075624 GGAATTAAAAAATCCCAAGTGGG + Intergenic
1118078902 14:62335495-62335517 GGTATGACAGAAGCCCAGGAGGG + Intergenic
1119671591 14:76523999-76524021 GGTATCCAAGAAGACCGTGTAGG - Intergenic
1120343749 14:83256230-83256252 GTGATCAAAGAAGCCCACATAGG - Intergenic
1120382966 14:83806204-83806226 TGTATCAAATAAGCCACAGTGGG + Intergenic
1120551490 14:85878127-85878149 TGTAGAAAAGAAGCCCAATTAGG - Intergenic
1122758909 14:104005645-104005667 GCAGTCAAAGAATCCCAAGTAGG - Intronic
1124183006 15:27496022-27496044 AGTATCACTGAAGGCCAAGTAGG - Intronic
1124706412 15:31970261-31970283 GATGTCAGAGAAGGCCAAGTGGG + Intergenic
1132720315 16:1312447-1312469 GGGATCAAAGAAGCCAAGGCAGG - Intronic
1136494590 16:30634553-30634575 GGGTTCAAAGAAGACCAAGCAGG + Intergenic
1137233033 16:46585905-46585927 GGTATCAATGAACGCCAAGTGGG + Intronic
1137469435 16:48741344-48741366 GGTATCAGATAAGCTCACGTAGG - Intergenic
1138331488 16:56219205-56219227 GGTTTCAAACAAGACCCAGTGGG - Intronic
1138577403 16:57916761-57916783 GGTCTCAAATTGGCCCAAGTAGG + Intronic
1143184866 17:5003997-5004019 GCAATCAAAGAAGCGAAAGTCGG + Exonic
1144292261 17:13837825-13837847 GGTATCAACAGAGACCAAGTGGG + Intergenic
1145015865 17:19397805-19397827 GGTAACAGAGAAGGCCAAGTAGG - Intergenic
1146157063 17:30533530-30533552 GATATCAAAGCAGCTCACGTTGG - Intergenic
1146932092 17:36784712-36784734 GGTATGAAAGAAGCAGAATTAGG + Intergenic
1149712369 17:58755487-58755509 GGGATCCAAGCAACCCAAGTGGG + Intergenic
1151318172 17:73336698-73336720 GAGTTCAAGGAAGCCCAAGTAGG - Exonic
1152423591 17:80207068-80207090 GATGGCAAAGAAGCTCAAGTAGG + Exonic
1152429047 17:80237243-80237265 GTTATTAAAGAATCCCAGGTTGG + Intronic
1153601245 18:6783183-6783205 GGAAGAAAAGAACCCCAAGTGGG - Intronic
1154001380 18:10485097-10485119 GCTATCAAAAAATCACAAGTTGG - Intronic
1154030196 18:10746696-10746718 TTTATAAAAGAAGCCCAAGGGGG + Intronic
1155676049 18:28430057-28430079 GGTATCAGAGAAGGCAGAGTAGG - Intergenic
1155723966 18:29055643-29055665 GGTAGCAAGTAAGTCCAAGTAGG + Intergenic
1156378721 18:36537526-36537548 GGTGTCAGAGAAAGCCAAGTAGG + Intronic
1162115171 19:8424858-8424880 GGTATCATACAAGCCTGAGTTGG + Intronic
1163827717 19:19532934-19532956 GGTATCAGAGAAGGCCAGGGTGG + Intronic
1165008917 19:32828962-32828984 GGTATCAAATCAGCCCATGAAGG + Intronic
1166990301 19:46688898-46688920 GGTTGCAAAGCAGCCCAGGTTGG - Intronic
1167341811 19:48921013-48921035 GTGGGCAAAGAAGCCCAAGTGGG - Intronic
1167533692 19:50035201-50035223 AGTATCACAGGAGCCCAAGAAGG + Intronic
1167534064 19:50038094-50038116 AGTATCACAGGAGCCCAAGGAGG - Intronic
925984920 2:9207414-9207436 GGTCTTAAAGAGGCCCAAGGTGG - Intronic
929090363 2:38210664-38210686 GGTATTAGAGAAGGCCAAGAAGG + Intergenic
931808767 2:65833978-65834000 GGTTTCAAAGAAAACCAAGAGGG + Intergenic
932235676 2:70119359-70119381 GGCAGCAAAGCAGCCCAGGTTGG + Intergenic
932970717 2:76537642-76537664 AGTGTCAGAGAAGGCCAAGTAGG + Intergenic
933630537 2:84651335-84651357 GGTGTCAGAGAAGGCCAAATAGG - Intronic
935010070 2:99126064-99126086 GATATCAGAGAAGGCTAAGTGGG - Intronic
935420972 2:102868682-102868704 TGTATCAATGAAGCCCAATGTGG + Intergenic
935800167 2:106687937-106687959 AGTGTCAATGAAGACCAAGTAGG - Intergenic
936272561 2:111060271-111060293 GGTGTCAGAGAAGGCCAAATGGG + Intronic
937240566 2:120459672-120459694 GGTATCAGAGAAGGCCCAGTGGG - Intergenic
937629847 2:124088801-124088823 GGTGTCAAATAAAGCCAAGTAGG - Intronic
941125430 2:161578582-161578604 GGTATCAAAGAAAGCCAAGTAGG - Intronic
942120440 2:172771264-172771286 CTTATAAAAGAAGCCCAAGGGGG - Intronic
944345138 2:198654945-198654967 GGTAGCAAATAACCCCAAGATGG + Intergenic
945359404 2:208878927-208878949 GGTGTCCAAGAATGCCAAGTAGG - Intergenic
947963138 2:234256827-234256849 AGTAACAAAGAAGCCCATGAGGG - Intergenic
1174961200 20:55159155-55159177 GATGTCAAAGAAGACCAAGTGGG - Intergenic
1177893992 21:26840115-26840137 GGTATCAAAGAAAGCCACATGGG + Intronic
1178406885 21:32331836-32331858 GGCATGAGAGAAGGCCAAGTAGG + Intronic
1179017660 21:37607003-37607025 GGTATCAAAGGAGTCCCACTTGG + Intergenic
1182039290 22:27224012-27224034 GGGATCAAAGAAGACCTGGTTGG + Intergenic
1183920377 22:41162274-41162296 AGTATAACAGAAGTCCAAGTTGG + Intronic
1184543735 22:45150744-45150766 GTTTTCAAAGAAGTCCAACTAGG + Intergenic
949543281 3:5050908-5050930 GGTCATAAAGAAGCCCAGGTTGG + Intergenic
949688715 3:6609241-6609263 GAGATCAGAGAAGGCCAAGTAGG - Intergenic
949725132 3:7035259-7035281 GGAAGCAAAGAAGCCAAATTAGG + Intronic
952481197 3:33763602-33763624 GGTGTCAGAGAAGACCAGGTGGG - Intergenic
953236029 3:41107996-41108018 GGTGTCAGAGAAGGCCAAATAGG - Intergenic
953396187 3:42572456-42572478 AGCATCAGAGAAGGCCAAGTAGG + Intronic
953832504 3:46312483-46312505 GGTATCAGCGAAGGCCAGGTAGG - Intergenic
954089988 3:48276634-48276656 GGTACCAAGGCACCCCAAGTTGG + Intronic
955933474 3:64080274-64080296 GGTACAAATGAAGCCCTAGTAGG - Intergenic
956310643 3:67875510-67875532 GTAATCAAGGAAGCACAAGTAGG + Intergenic
957549541 3:81686045-81686067 GGTATCACTGAAGCCCAAGGAGG - Intronic
960608431 3:119532023-119532045 GGTGTCACAGAAGTCCAAGAAGG - Intronic
961780158 3:129316370-129316392 GGGCTCCAAGAAGCACAAGTTGG - Intergenic
962121527 3:132565472-132565494 GGTGTCAAAGAAAGCCAAGAAGG + Intronic
962260637 3:133901345-133901367 GGTATCACAGAAGGTCAAGATGG - Intergenic
963986493 3:151601101-151601123 GGTATCAAAGGAAGCTAAGTGGG - Intergenic
965049164 3:163622377-163622399 GGTATCAATGAAGTCCTTGTGGG - Intergenic
965523347 3:169690787-169690809 GGTATCAAAGAACTCAAACTGGG - Intergenic
966345370 3:178973441-178973463 TGCATCAGAGAAGGCCAAGTGGG + Intergenic
968399984 4:285722-285744 GGTATCACAGCAGCCCTAGTTGG - Intronic
969037812 4:4269453-4269475 GGTGTCACAGAAGGCCAAGCAGG + Intronic
973873375 4:55188841-55188863 GGTGTCAAAAGAGGCCAAGTGGG + Intergenic
975463984 4:74688517-74688539 GGTTTCAGAGAAGGCTAAGTGGG - Intergenic
977946012 4:102914882-102914904 AGTCTCAAAGAACTCCAAGTTGG + Intronic
982085382 4:151830386-151830408 GGTATAAAAGAATCCCTAGTGGG - Intergenic
985088033 4:186334338-186334360 GGCATCAGAGAAGGCCAAGTAGG - Intergenic
985088655 4:186341696-186341718 GGTATCAAAGACCCCAAATTTGG - Intergenic
985382244 4:189406661-189406683 GACATCAAAGAAACCCAGGTGGG - Intergenic
987092073 5:14517035-14517057 GGTGTTAGAGAAGCCCAAATGGG - Intronic
987186886 5:15430627-15430649 GGTATCATTGGAGGCCAAGTAGG - Intergenic
988774744 5:34467620-34467642 AGGAACAAAGAAGGCCAAGTTGG + Intergenic
989315128 5:40069668-40069690 GGAAACAAAGAAGGCCAAGGTGG - Intergenic
989776249 5:45210967-45210989 TGTATCAAAAAAACCCAATTGGG - Intergenic
992681351 5:79156506-79156528 GTTTTGAAAGAAACCCAAGTAGG - Intronic
994172387 5:96671605-96671627 GGTAGCAAAGAAGACCACATAGG + Intronic
995790026 5:115876773-115876795 AGTATCAAACAAACCCAAATTGG - Intronic
996744871 5:126838916-126838938 GGTATAAAAGAAACCCCAGAAGG - Intergenic
996826279 5:127684921-127684943 GGTATCAAATGACTCCAAGTGGG + Intergenic
998273903 5:140733385-140733407 GGTGTTAAAGAAGGCCAAATAGG + Intergenic
998954458 5:147424584-147424606 GGTATCAAAGGAGTTGAAGTCGG - Intronic
1000543157 5:162566127-162566149 GGTGTCAGAGATGACCAAGTGGG - Intergenic
1001142568 5:169157107-169157129 AGTATCAGAGAAGGCCAAGTAGG + Intronic
1001537956 5:172512348-172512370 TGAATTCAAGAAGCCCAAGTAGG + Intergenic
1002339835 5:178508571-178508593 GATATCAACAAAGACCAAGTGGG - Intronic
1004420348 6:15464177-15464199 GGTAAAAATGAAGCCAAAGTAGG - Intronic
1005459624 6:26056008-26056030 GGCAGCCAAGAAGCCCAAGAAGG - Exonic
1005478736 6:26234510-26234532 GGCAGCCAAGAAGCCCAAGAAGG - Exonic
1006265748 6:32921819-32921841 GGTATCCAAGAAGACCAATTAGG + Intergenic
1006307124 6:33229768-33229790 GTTATAAAAGAAGCCCAGGCTGG + Intergenic
1007368747 6:41412705-41412727 GGCATCAGAGAAGCCCGAATGGG - Intergenic
1008079879 6:47182578-47182600 ATTGTCAAAGAAGCCCAGGTAGG + Intergenic
1008360614 6:50613281-50613303 GGCATCAGAGAAGGCCAAGTAGG + Intergenic
1008953180 6:57183026-57183048 GGCACCAAAGGAGCCCAAGTAGG - Intronic
1011973626 6:93262362-93262384 CATATCAAATAATCCCAAGTGGG + Intronic
1012762682 6:103321610-103321632 TGTATCAGAAAAGGCCAAGTAGG + Intergenic
1013257845 6:108407083-108407105 GATGTCACAGAAGGCCAAGTAGG - Intronic
1013349605 6:109293338-109293360 GGATTCAAACAAGCCCAGGTAGG - Intergenic
1014201158 6:118610362-118610384 AGTATCCAAGAAGCCCAAGTAGG + Intronic
1014300876 6:119679792-119679814 GGCCTCAAAGAAGCACAAGGTGG - Intergenic
1014312555 6:119822451-119822473 CCTATCTAAGAAGCCCACGTGGG + Intergenic
1016403908 6:143709919-143709941 GGTGTCAGAGAAGACCAAGCAGG - Intronic
1020706998 7:11557831-11557853 GGTGTTAGAGAAGGCCAAGTAGG - Intronic
1021737899 7:23657155-23657177 GGTATGAAGGCACCCCAAGTTGG + Intergenic
1023021460 7:36015285-36015307 GGTGTCAAAAAAAACCAAGTTGG - Intergenic
1024120668 7:46235329-46235351 GGTGTCAGAGAAGGCCAGGTAGG + Intergenic
1025604303 7:63028375-63028397 GTCATCAAAGATGACCAAGTTGG - Intergenic
1027360172 7:77400182-77400204 AGTATCAAAGAAGACCAAGTAGG + Intronic
1027360223 7:77400437-77400459 GGTATCAGTGGAGGCCAAGTGGG + Intronic
1027360236 7:77400513-77400535 GGTGTCCAAGTAGGCCAAGTGGG + Intronic
1027766755 7:82353648-82353670 GGTATCACAAAAGCCAAAGAAGG + Intronic
1027779377 7:82503523-82503545 AGTGTCAGAGAAGGCCAAGTAGG + Intergenic
1029474499 7:100775144-100775166 GGTATCAAACCAGCCCACCTTGG + Intronic
1033611810 7:142970547-142970569 GGTATCAGAGAAGGCCAAGTAGG + Intergenic
1033635678 7:143209527-143209549 GTTCCCAAAGAAGCCCCAGTGGG + Intergenic
1035347609 7:158214640-158214662 AGTGTCAGAGAAGGCCAAGTAGG + Intronic
1038968942 8:32609303-32609325 GTTGTCAAAGAAGCCTCAGTTGG + Intronic
1041122432 8:54600581-54600603 GATATCAGTGAAGGCCAAGTGGG - Intergenic
1047219120 8:122904402-122904424 GGTGTCAGAGAAGGCCAAGTGGG + Intronic
1047360746 8:124166670-124166692 GGTGTCAGAAAAGCCCAAGTAGG - Intergenic
1050495886 9:6241969-6241991 TGTATCAAATATGCCAAAGTTGG - Intronic
1051505407 9:17821874-17821896 GGTATCCATGAAGGCCAACTGGG - Intergenic
1051864170 9:21660390-21660412 GGTATCTAAGAAGTTCAAGGTGG + Intergenic
1052726498 9:32234212-32234234 GGTGTCAAAGAAGACCATATGGG + Intergenic
1054726112 9:68651881-68651903 TCTATCAAAGAAACCCAATTAGG - Intergenic
1055037405 9:71832546-71832568 GGTGTTAGAGAAGACCAAGTGGG + Intergenic
1057089045 9:92239745-92239767 GGTATCAGAGAAGACAAAGTAGG - Intronic
1059707136 9:116836054-116836076 GGTATCAGAGAAGGCCACATGGG - Intronic
1059912401 9:119059803-119059825 GGTGTCAGAGAAGGCAAAGTAGG + Intergenic
1060539401 9:124419615-124419637 GATACCAAAGAAACCCAGGTAGG - Intergenic
1187500077 X:19832465-19832487 GGTATAAAGAAAGCCCAAGGTGG + Intronic
1188953002 X:36399775-36399797 GGTGTCAGAGAAGCACAAGTAGG - Intergenic
1189428767 X:40928925-40928947 AGTATCAGAGAAGGCCAAGTGGG - Intergenic
1192005199 X:67204212-67204234 GGTATCAGAGAAACCTGAGTGGG - Intergenic
1192188672 X:68977129-68977151 GGTATCAGAGAAGGCTGAGTGGG - Intergenic
1193386158 X:80873686-80873708 AGTATCATAGAAGCCTAAGTTGG - Intergenic
1195694570 X:107657275-107657297 GGTGTCAGAGAAGTCCAAGTAGG - Intergenic
1195901157 X:109798911-109798933 GGTGTCAGAGAAGGCCAAGTAGG + Intergenic
1196128553 X:112126605-112126627 GGAATCAATGAAGCCAAAATTGG + Intergenic
1198044405 X:132886576-132886598 AAGATCAAAGAATCCCAAGTAGG + Intronic
1198688852 X:139258253-139258275 TGTGTCAGAGAAGACCAAGTAGG - Intergenic
1199225740 X:145371046-145371068 GGTATCCAAGAATCCCATGGAGG - Intergenic