ID: 1093097288

View in Genome Browser
Species Human (GRCh38)
Location 12:14985707-14985729
Sequence TACCCAGTGCTGAAACAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 171}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093097288_1093097290 9 Left 1093097288 12:14985707-14985729 CCTGTTTGTTTCAGCACTGGGTA 0: 1
1: 0
2: 2
3: 24
4: 171
Right 1093097290 12:14985739-14985761 ATTAATGGTGCCAGTGAGCTAGG 0: 1
1: 0
2: 0
3: 16
4: 143
1093097288_1093097289 -6 Left 1093097288 12:14985707-14985729 CCTGTTTGTTTCAGCACTGGGTA 0: 1
1: 0
2: 2
3: 24
4: 171
Right 1093097289 12:14985724-14985746 TGGGTAGAAGTTGAGATTAATGG 0: 1
1: 0
2: 1
3: 13
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093097288 Original CRISPR TACCCAGTGCTGAAACAAAC AGG (reversed) Intergenic
900034826 1:398465-398487 AACCCAGGTCTGAAACAAATAGG + Intergenic
900055655 1:628343-628365 AACCCAGGTCTGAAACAAATAGG + Intergenic
905474025 1:38213330-38213352 TTCCAAGAGCTGAAACAAAAGGG - Intergenic
905859051 1:41334495-41334517 TAAACAGTGTTGCAACAAACAGG + Intergenic
908017305 1:59856857-59856879 TATCCAGTGCTGAGACAATGCGG + Intronic
909385353 1:75049052-75049074 TAAACAGTGCTGCAACAAACAGG - Intergenic
910458872 1:87426845-87426867 TACTCTGTGCTGAAAGACACAGG - Intergenic
910464563 1:87483997-87484019 TAAACAGTGCTATAACAAACAGG + Intergenic
910581682 1:88834133-88834155 TAAACAGTGCTGAAACAAACAGG + Exonic
913463799 1:119117621-119117643 TAACCAGTACTGAAGAAAACTGG + Intronic
913519848 1:119634377-119634399 TACCCACTGCTGAAATGCACTGG - Intronic
914359336 1:146918706-146918728 TAAACAGTGCTATAACAAACAGG + Intergenic
914494413 1:148181169-148181191 TAAACAGTGCTATAACAAACAGG - Intergenic
918544043 1:185662040-185662062 AAGCTAGTGCTGAAACAAAATGG + Intergenic
921093714 1:211868498-211868520 TTACCAGTGCTGAACCAATCTGG - Intergenic
921399383 1:214703826-214703848 TAAATAGTGCTGCAACAAACAGG + Intergenic
922131622 1:222786252-222786274 TACCAGGTGCTGAAACAATAGGG - Intergenic
922257354 1:223904023-223904045 AACCCAGGTCTGAAACAAATAGG + Intergenic
923601644 1:235408779-235408801 TAAACATTCCTGAAACAAACAGG + Intronic
924315421 1:242790344-242790366 TTCCCAGTAATCAAACAAACAGG - Intergenic
1063880418 10:10525836-10525858 TACCCAGTGGTGGATCATACTGG + Intergenic
1064068584 10:12205361-12205383 TAAACAGTGCTGCAACAAACAGG + Intronic
1066310747 10:34193636-34193658 TACCCATTGCTAAAAGAAATAGG - Intronic
1068421917 10:56805379-56805401 TAGCCAATACTGAAACAAAGAGG + Intergenic
1068556338 10:58463346-58463368 TAAACAGTGCTGCAACAAACAGG + Intergenic
1069046605 10:63750016-63750038 TACCAAGTGCTGAAACTGATAGG + Intergenic
1072092627 10:92144120-92144142 TACCGTGTGCTAAAATAAACTGG + Intronic
1072106485 10:92279385-92279407 TACCCAGAACTCAAACAAATAGG - Intronic
1073677011 10:105659433-105659455 TACCCAGTTCAAAAACAAAGAGG + Intergenic
1074389685 10:113046324-113046346 CAAACAGTGCTGAAAAAAACGGG - Intronic
1074799249 10:116982552-116982574 AAGCCAGTTCTGAAACAAAAAGG - Intronic
1075851513 10:125592109-125592131 AAACCAGTGCTCAAACAGACTGG - Intronic
1075955862 10:126522336-126522358 TCCCCACTGCTGAAGCAAAAGGG + Intronic
1076555045 10:131316085-131316107 TACACATTGTTTAAACAAACAGG - Intergenic
1084294286 11:68200903-68200925 TACCCAGCACTGAAATCAACAGG + Intronic
1085553580 11:77398623-77398645 TGAACAGTGCTGCAACAAACAGG + Intronic
1085765395 11:79277550-79277572 CTGCCAGTGTTGAAACAAACAGG - Intronic
1085913329 11:80854727-80854749 TATCCTGTGCTGACACAGACAGG + Intergenic
1086007389 11:82053708-82053730 TAAACAATGCTGCAACAAACAGG - Intergenic
1086033578 11:82389234-82389256 TGCCCAGGGCTGAGACAACCAGG + Intergenic
1086865123 11:91971262-91971284 TACCCAGAGCTGACACATAAGGG + Intergenic
1088909529 11:114180314-114180336 TACCCAGTTGTGAAAGAGACAGG - Intronic
1090263214 11:125337669-125337691 TTCCCTGTGCTGAAGCAGACAGG - Intronic
1092781670 12:11993381-11993403 TACAGAAGGCTGAAACAAACTGG - Intergenic
1092950057 12:13493922-13493944 TAAACAGTGCTACAACAAACAGG + Intergenic
1093097288 12:14985707-14985729 TACCCAGTGCTGAAACAAACAGG - Intergenic
1093108145 12:15114737-15114759 GACCCAGTGCTGTAAGAACCTGG - Intronic
1093253294 12:16835016-16835038 TGCCAACAGCTGAAACAAACAGG - Intergenic
1095213161 12:39517587-39517609 TGAACAGTGCTGCAACAAACAGG - Intergenic
1095963773 12:47852707-47852729 TTCTCAGGGCAGAAACAAACTGG + Intronic
1097450654 12:59733663-59733685 TAACCAGGGCTGAAACACTCCGG - Intronic
1097580976 12:61455970-61455992 TACACAGTGGTGAACCAAACAGG - Intergenic
1097917672 12:65038211-65038233 CACCCAGAGATGAAACCAACTGG - Intergenic
1099428545 12:82553355-82553377 AGCCCAGTGCTGAGATAAACTGG + Intergenic
1102024821 12:109708428-109708450 TCCCCAGTGGTGAAACAAGGGGG + Intergenic
1104318795 12:127730263-127730285 TTATCAGTGCTGCAACAAACTGG - Intergenic
1105335899 13:19468456-19468478 TGAACAGTGCTGCAACAAACAGG + Intronic
1107496390 13:40929550-40929572 CACCCAGTTCTGACACCAACTGG - Intergenic
1109086620 13:57981105-57981127 TACCCTGTTCTAAAGCAAACAGG + Intergenic
1110597161 13:77331825-77331847 TAAACAGTGCTGCAACAAACAGG + Intergenic
1110848026 13:80212024-80212046 AACCCATTGCTGATACAATCAGG - Intergenic
1112433228 13:99371557-99371579 TAGACAGTGGTTAAACAAACTGG - Intronic
1114347776 14:21814883-21814905 TGAACAGTGCTGCAACAAACGGG - Intergenic
1114368999 14:22064594-22064616 TAAACAGTGCTGCAACAAACAGG - Intergenic
1116180826 14:41531357-41531379 AACTCACTGGTGAAACAAACAGG + Intergenic
1117233172 14:53743207-53743229 TACCTAGTGCTGAAAAGAAAAGG + Intergenic
1120522619 14:85542356-85542378 TTCACAGTGTTGAAAAAAACAGG - Intronic
1121148141 14:91604617-91604639 CACCCAGTCCTGGAACAATCAGG - Intronic
1121591298 14:95113684-95113706 AGCCCAGTGCTGACACAAAAAGG + Intronic
1121779804 14:96615099-96615121 TGCACAGTCCAGAAACAAACTGG + Intergenic
1127804899 15:62510205-62510227 TGCCCAGTGCTGACCCAAAGGGG - Intronic
1128667141 15:69546964-69546986 TTCCCAGAGCTGAAACAAAGTGG + Intergenic
1130374032 15:83312215-83312237 TGCCCAGTGCTCCAACAAAGGGG + Intergenic
1130870910 15:87971585-87971607 GACCCAGTGCTGAGAAAGACTGG + Intronic
1131949970 15:97671501-97671523 TAAGCAGTGCTGCAACAAACAGG + Intergenic
1134305590 16:13029188-13029210 TGAACAGTGCTGCAACAAACAGG - Intronic
1135107781 16:19665619-19665641 TGAACAGTGCTAAAACAAACAGG + Intronic
1135879928 16:26245265-26245287 TAAACGGTGCTGCAACAAACAGG - Intergenic
1137852798 16:51763190-51763212 TACCCAGTCCCATAACAAACAGG + Intergenic
1140639587 16:76956812-76956834 TACTCATTGCTCAAACAATCAGG - Intergenic
1142943822 17:3407833-3407855 TACACTGTCCTGAGACAAACAGG - Intergenic
1145014072 17:19385553-19385575 AACCCAGTCCTTTAACAAACTGG - Intronic
1145053027 17:19678901-19678923 TAGCCACTGCGGAAGCAAACAGG + Exonic
1149784631 17:59424510-59424532 TGCCCAGAGCTGAAACCAAGAGG - Intergenic
1154122533 18:11663536-11663558 TCTCCAGTGCTGAAATATACAGG + Intergenic
1157156504 18:45272292-45272314 TAAACAGTGCTGCAACAAACAGG - Intronic
1157419177 18:47531183-47531205 TAACCAGTGGCCAAACAAACCGG + Intergenic
1162142285 19:8592088-8592110 CACCCAGTGGTGCTACAAACGGG - Exonic
1163550831 19:17965808-17965830 TGCCCAGGGCTGAGACAATCAGG - Intronic
1165539531 19:36480622-36480644 TAAACAGTGCTGAAACAACTAGG + Intronic
1167057841 19:47123947-47123969 TACCAAGAGCAGAAAGAAACAGG - Intronic
925951753 2:8920267-8920289 TACACAGTGCTGGGACAATCAGG - Intronic
926216243 2:10907281-10907303 GGCCCAGTGCTGAGACAAGCGGG - Intergenic
927309324 2:21611413-21611435 TAAGCAGTGCTGCAACAAATAGG + Intergenic
928742242 2:34368899-34368921 TACCATGTGATGAAACTAACTGG - Intergenic
933845605 2:86324526-86324548 CACCCACTGCTGAAAGAAAACGG + Intronic
934508234 2:94913906-94913928 TACCCAGAGTTGAGACAAAGAGG - Intergenic
938961085 2:136342299-136342321 AAACCATGGCTGAAACAAACAGG + Intergenic
938983961 2:136554857-136554879 TAGCCAGGGCTGCAGCAAACAGG + Intergenic
939256700 2:139752990-139753012 TAATCAGGGCTGCAACAAACAGG + Intergenic
940693397 2:156948270-156948292 TTCACAGTCCTGACACAAACAGG - Intergenic
941302538 2:163821639-163821661 TGAACAGTGCTGCAACAAACAGG + Intergenic
942356096 2:175112227-175112249 TACCTAGTGATGAAAGCAACCGG - Intronic
942806089 2:179932323-179932345 GACCAAGAGCTCAAACAAACAGG + Intergenic
946705286 2:222452605-222452627 CACCCAGTTCTGGAACAATCAGG - Intronic
946868509 2:224064488-224064510 TGCCAAGTGCTGAAATACACTGG - Intergenic
948105989 2:235414197-235414219 TAACCAGTGCTGAGAAAGACTGG - Intergenic
949060681 2:241955310-241955332 TCCCCAGTACTGGAACAAGCAGG + Intergenic
1172477032 20:35246826-35246848 TAACCAGTTCTGAAAGACACGGG - Exonic
1174252750 20:49231718-49231740 TCCACAGTTCTGGAACAAACCGG + Intronic
1175028875 20:55932395-55932417 TACACAGTGCTAAAATAAACAGG + Intergenic
1184579859 22:45408950-45408972 TACCCAGAGCTGAAGAAATCAGG + Intronic
1184835066 22:47016195-47016217 TTCCCAGGGCTGAAACAAAGGGG - Intronic
950461330 3:13123967-13123989 TACCCAATGCAGAAATGAACAGG - Intergenic
951033935 3:17912520-17912542 TTCCCACTGCTGAAAGAAATTGG - Intronic
953864236 3:46570587-46570609 TAAACAGTGCTGCAACAAACAGG - Intronic
957904322 3:86538007-86538029 TACTCAGTGCTAAAAAAAAGAGG - Intergenic
959104955 3:102055001-102055023 TCCCCAGAGCTGGAACATACTGG - Intergenic
959158000 3:102689881-102689903 TGCCTAGTGCTTAAACCAACTGG - Intergenic
959797643 3:110450952-110450974 TAAACAGTGCTGCAACAAACAGG + Intergenic
960158608 3:114324079-114324101 TACTTTGAGCTGAAACAAACAGG - Intergenic
960681900 3:120257226-120257248 TAAGCAATGCTGCAACAAACAGG - Intronic
963335165 3:143966793-143966815 TGTTCTGTGCTGAAACAAACTGG + Intergenic
965054834 3:163698827-163698849 TTCCCAGTGCTGACCCACACTGG - Intergenic
965948408 3:174271543-174271565 TAACCAGGCCTGAAATAAACCGG - Intronic
966318449 3:178674843-178674865 TTGCCATTGCTGGAACAAACTGG + Intronic
969033398 4:4231021-4231043 TACCCAGTAATGAAACCACCAGG + Intergenic
969471891 4:7394033-7394055 TGCCCAGGGCTGAAACAAGGAGG - Intronic
970198541 4:13577116-13577138 TTGCAAGTGCTGAAACAAAAAGG - Intronic
971643773 4:29169496-29169518 TATCCAGTACTCACACAAACAGG + Intergenic
972271804 4:37518213-37518235 TAAACAGTGCTGCAACAAACAGG + Intronic
973532366 4:51845183-51845205 AACCCAGTGCTTACACACACTGG - Intronic
975548151 4:75581807-75581829 TACCCAGTTCAGAACCAAAATGG + Exonic
978262919 4:106783767-106783789 TAAACAGTGTTGCAACAAACAGG - Intergenic
980437138 4:132791749-132791771 TAAACAGTGCTGCAACAAACAGG + Intergenic
981473085 4:145159155-145159177 TACCCAGTAATGAAATAAAATGG - Intronic
981920694 4:150081102-150081124 TAACAAGTGCTTAAGCAAACAGG - Intronic
983258904 4:165433639-165433661 TAGCCAGTGCATAAAGAAACAGG + Intronic
987112073 5:14697660-14697682 TTCACAATGCTTAAACAAACTGG - Exonic
987369630 5:17181324-17181346 CACCCAGTGCTGACACCCACAGG + Intronic
989194063 5:38698973-38698995 TACCCATTGCTGAAGTAAATTGG + Intergenic
989735475 5:44698656-44698678 TACCCATTTCTGACATAAACAGG + Intergenic
990157228 5:52891169-52891191 TAAACAGTGCTGCAATAAACAGG + Intronic
990160765 5:52937476-52937498 TACCCTGTGCTGTACCCAACTGG + Exonic
995967294 5:117922942-117922964 AACTCAATGCTAAAACAAACGGG + Intergenic
995998726 5:118332620-118332642 AACCCAGTGCTGATACAAGGAGG + Intergenic
996105129 5:119492366-119492388 TAGCCAGTTCTGAATAAAACAGG - Intronic
996132814 5:119802552-119802574 TAAACAGTGCTGCAACAAACAGG + Intergenic
999798426 5:155009656-155009678 AACCCAGTGGCAAAACAAACTGG + Intergenic
1001620559 5:173081441-173081463 TCCCCAGCACTGAAACAAACAGG - Intronic
1002738993 5:181420406-181420428 AACCCAGGTCTGAAACAAATAGG - Intergenic
1005696138 6:28354488-28354510 CACCCAGGGCTGATACACACAGG + Intronic
1015349357 6:132198682-132198704 TACCCAGTGATAGAACCAACTGG + Intergenic
1016561804 6:145403705-145403727 TAAACAGTGTTGCAACAAACAGG + Intergenic
1017475338 6:154785478-154785500 TACCAAGTGCTGACAAAAATGGG - Intronic
1017698231 6:157040312-157040334 TTCCCAGTGCTTACAAAAACAGG - Intronic
1018816065 6:167332222-167332244 AACCCCGTGCTGTAACAAACAGG - Intronic
1019244102 6:170695958-170695980 AACCCAGGTCTGAAACAAATAGG - Intergenic
1020366287 7:7384206-7384228 AACCCAGTGCAGTAACATACTGG + Intronic
1022312803 7:29212979-29213001 CACCCAGTCCTGGAACAATCAGG + Intronic
1024498784 7:50077941-50077963 TAAGCAGTGCTGCAACACACAGG - Intronic
1025577021 7:62658748-62658770 TACCAACTGCTCAAAAAAACAGG + Intergenic
1026971410 7:74470639-74470661 TGCCCAGTGAATAAACAAACTGG + Intronic
1033758033 7:144411896-144411918 TATACATTGTTGAAACAAACTGG - Intergenic
1034143638 7:148848613-148848635 TACTCAGAGCTGTAACAAAGGGG + Intronic
1035504023 8:112202-112224 AACCCAGGTCTGAAACAAATAGG + Intergenic
1036475188 8:9086655-9086677 TAAACAGTGCTGAAACCAACAGG - Intronic
1037495228 8:19433915-19433937 CAGCCAGTGGTGAAACAAAATGG - Intronic
1038535923 8:28352734-28352756 TACCCAGTGGGGACTCAAACTGG + Intronic
1040309898 8:46231492-46231514 TACCCAGGGCTGTATCAAGCAGG + Intergenic
1040852104 8:51911614-51911636 TACCCAGTTCTGAAACAAAGTGG + Intergenic
1041122106 8:54596960-54596982 GACACAGTGCTGACAGAAACCGG - Intergenic
1041495982 8:58485815-58485837 TACTATTTGCTGAAACAAACTGG - Intergenic
1045239109 8:100383100-100383122 TAGGCAGTGCTGAAATATACGGG + Intronic
1046681759 8:117178437-117178459 TACCAAGTTCTGGAATAAACAGG - Intergenic
1046915073 8:119671325-119671347 GACACAGTGCAGAAACAAAGTGG + Intronic
1052514899 9:29467701-29467723 TACCCAGTGCTCAAAGGATCAGG - Intergenic
1052927949 9:34033166-34033188 TAAACAGTGCTGCAACAAACAGG - Intronic
1057283610 9:93729790-93729812 CACCCAGTGTTGAAAAAAATGGG - Intergenic
1059662865 9:116419087-116419109 GACCCAGTCCTGACACTAACAGG - Intergenic
1203604292 Un_KI270748v1:45182-45204 AACCCAGGTCTGAAACAAATAGG - Intergenic
1186076993 X:5891445-5891467 GACCGAGTGCTTAAACAAAAAGG + Exonic
1187629692 X:21155439-21155461 TACCGAGTAATGAAACCAACTGG + Intergenic
1188199449 X:27281025-27281047 TATCCAGTGCTGAAACAGAAAGG + Intergenic
1189670909 X:43407873-43407895 CACCCAGTCCTGGAACAATCAGG - Intergenic
1191752438 X:64557530-64557552 GCCCCAGTGCTGAAAAGAACTGG - Intergenic
1191873753 X:65772948-65772970 CACCCAGTCCTGGAACAATCAGG - Intergenic
1193291794 X:79781776-79781798 TACCCAGTGGTGAAGGCAACTGG - Intergenic
1195133241 X:101875869-101875891 TAAACAGTGCTGCAACAAACAGG - Intergenic
1195168282 X:102241489-102241511 TAAACAGTGCTGCAACAAACAGG + Intergenic
1195190575 X:102445598-102445620 TAAACAGTGCTGCAACAAACAGG - Intronic
1195801286 X:108714174-108714196 TAAACAGTGCTACAACAAACAGG + Intergenic
1196308354 X:114130714-114130736 TGAACAGTGCTGCAACAAACAGG + Intergenic
1199035575 X:143046200-143046222 TGAACAGTGCTGCAACAAACAGG + Intergenic
1201309523 Y:12583688-12583710 TAAACAATGCTAAAACAAACAGG - Intergenic
1202386341 Y:24330228-24330250 AACCCAGGTCTGAAACAAATAGG - Intergenic
1202484445 Y:25339900-25339922 AACCCAGGTCTGAAACAAATAGG + Intergenic
1202595918 Y:26539856-26539878 TGAACAGTGCTGCAACAAACAGG - Intergenic