ID: 1093097530

View in Genome Browser
Species Human (GRCh38)
Location 12:14988904-14988926
Sequence GGAAATGGATGAAAAGCTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093097522_1093097530 10 Left 1093097522 12:14988871-14988893 CCGGGGACTACTAAACGGGGAGG No data
Right 1093097530 12:14988904-14988926 GGAAATGGATGAAAAGCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093097530 Original CRISPR GGAAATGGATGAAAAGCTAT TGG Intergenic
No off target data available for this crispr