ID: 1093102469

View in Genome Browser
Species Human (GRCh38)
Location 12:15044615-15044637
Sequence TTATGCCTGCTCCCTGCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093102469_1093102474 26 Left 1093102469 12:15044615-15044637 CCCAGTGCAGGGAGCAGGCATAA No data
Right 1093102474 12:15044664-15044686 ATTTCCCACTAAAAGAGCTTTGG No data
1093102469_1093102471 -9 Left 1093102469 12:15044615-15044637 CCCAGTGCAGGGAGCAGGCATAA No data
Right 1093102471 12:15044629-15044651 CAGGCATAATGCCCAGATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093102469 Original CRISPR TTATGCCTGCTCCCTGCACT GGG (reversed) Intergenic
No off target data available for this crispr