ID: 1093102471

View in Genome Browser
Species Human (GRCh38)
Location 12:15044629-15044651
Sequence CAGGCATAATGCCCAGATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093102464_1093102471 9 Left 1093102464 12:15044597-15044619 CCTAAAAGCAATGATAACCCCAG No data
Right 1093102471 12:15044629-15044651 CAGGCATAATGCCCAGATTGTGG No data
1093102469_1093102471 -9 Left 1093102469 12:15044615-15044637 CCCAGTGCAGGGAGCAGGCATAA No data
Right 1093102471 12:15044629-15044651 CAGGCATAATGCCCAGATTGTGG No data
1093102468_1093102471 -8 Left 1093102468 12:15044614-15044636 CCCCAGTGCAGGGAGCAGGCATA No data
Right 1093102471 12:15044629-15044651 CAGGCATAATGCCCAGATTGTGG No data
1093102470_1093102471 -10 Left 1093102470 12:15044616-15044638 CCAGTGCAGGGAGCAGGCATAAT No data
Right 1093102471 12:15044629-15044651 CAGGCATAATGCCCAGATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093102471 Original CRISPR CAGGCATAATGCCCAGATTG TGG Intergenic
No off target data available for this crispr