ID: 1093102472

View in Genome Browser
Species Human (GRCh38)
Location 12:15044640-15044662
Sequence TTTCTTAGAAACCACAATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093102472_1093102474 1 Left 1093102472 12:15044640-15044662 CCCAGATTGTGGTTTCTAAGAAA No data
Right 1093102474 12:15044664-15044686 ATTTCCCACTAAAAGAGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093102472 Original CRISPR TTTCTTAGAAACCACAATCT GGG (reversed) Intergenic
No off target data available for this crispr