ID: 1093102473

View in Genome Browser
Species Human (GRCh38)
Location 12:15044641-15044663
Sequence ATTTCTTAGAAACCACAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093102473_1093102474 0 Left 1093102473 12:15044641-15044663 CCAGATTGTGGTTTCTAAGAAAT No data
Right 1093102474 12:15044664-15044686 ATTTCCCACTAAAAGAGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093102473 Original CRISPR ATTTCTTAGAAACCACAATC TGG (reversed) Intergenic
No off target data available for this crispr