ID: 1093102474

View in Genome Browser
Species Human (GRCh38)
Location 12:15044664-15044686
Sequence ATTTCCCACTAAAAGAGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093102470_1093102474 25 Left 1093102470 12:15044616-15044638 CCAGTGCAGGGAGCAGGCATAAT No data
Right 1093102474 12:15044664-15044686 ATTTCCCACTAAAAGAGCTTTGG No data
1093102473_1093102474 0 Left 1093102473 12:15044641-15044663 CCAGATTGTGGTTTCTAAGAAAT No data
Right 1093102474 12:15044664-15044686 ATTTCCCACTAAAAGAGCTTTGG No data
1093102472_1093102474 1 Left 1093102472 12:15044640-15044662 CCCAGATTGTGGTTTCTAAGAAA No data
Right 1093102474 12:15044664-15044686 ATTTCCCACTAAAAGAGCTTTGG No data
1093102469_1093102474 26 Left 1093102469 12:15044615-15044637 CCCAGTGCAGGGAGCAGGCATAA No data
Right 1093102474 12:15044664-15044686 ATTTCCCACTAAAAGAGCTTTGG No data
1093102468_1093102474 27 Left 1093102468 12:15044614-15044636 CCCCAGTGCAGGGAGCAGGCATA No data
Right 1093102474 12:15044664-15044686 ATTTCCCACTAAAAGAGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093102474 Original CRISPR ATTTCCCACTAAAAGAGCTT TGG Intergenic
No off target data available for this crispr