ID: 1093104242

View in Genome Browser
Species Human (GRCh38)
Location 12:15066382-15066404
Sequence ACCTGGGACAAAATACATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093104242_1093104246 14 Left 1093104242 12:15066382-15066404 CCCTCATGTATTTTGTCCCAGGT No data
Right 1093104246 12:15066419-15066441 TTAATCTCGAAAGCATTAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093104242 Original CRISPR ACCTGGGACAAAATACATGA GGG (reversed) Intergenic
No off target data available for this crispr