ID: 1093108145

View in Genome Browser
Species Human (GRCh38)
Location 12:15114737-15114759
Sequence GACCCAGTGCTGTAAGAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 105}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093108145_1093108149 20 Left 1093108145 12:15114737-15114759 CCAGGTTCTTACAGCACTGGGTC 0: 1
1: 0
2: 0
3: 7
4: 105
Right 1093108149 12:15114780-15114802 CAGTAACATCTGGCTCACCTAGG 0: 1
1: 0
2: 0
3: 23
4: 290
1093108145_1093108146 10 Left 1093108145 12:15114737-15114759 CCAGGTTCTTACAGCACTGGGTC 0: 1
1: 0
2: 0
3: 7
4: 105
Right 1093108146 12:15114770-15114792 GTGCCTGAACCAGTAACATCTGG 0: 1
1: 0
2: 0
3: 9
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093108145 Original CRISPR GACCCAGTGCTGTAAGAACC TGG (reversed) Intronic
904865761 1:33577711-33577733 GACCCAGTGCTTCATGAAGCTGG - Intronic
907602752 1:55787325-55787347 GACCCAGTACTTTAACAACTGGG - Intergenic
907744698 1:57201360-57201382 GAACCAGTCCTTTAAGACCCAGG + Intronic
913149391 1:116025674-116025696 GACACAGAGCTGTAAGTAGCAGG - Intronic
916878123 1:168992165-168992187 GACTCAGTCCTGAAAGAACTTGG - Intergenic
919848151 1:201654570-201654592 GAGCCAGTGCTGTATGGAGCAGG + Intronic
920802975 1:209206998-209207020 GACCCAGCTCTGTGAGAACTCGG + Intergenic
924501743 1:244644676-244644698 GACCCAGTGCTGGTAGACACAGG + Intergenic
1066279924 10:33906526-33906548 GACCCACTGCAGTAAGCCCCTGG - Intergenic
1066332032 10:34434162-34434184 GACCCAGAGATGCAAGAACAGGG + Intronic
1067468647 10:46520584-46520606 CACACAGTTCTGTAAGAAACGGG - Intergenic
1067837739 10:49652049-49652071 GACACAGTGCTGTAGGATCTAGG + Intronic
1068613081 10:59082239-59082261 GAACCACTGCTGTAAGAGCTTGG + Intergenic
1068813482 10:61283200-61283222 GAACCACTGCTGTAAGAGGCTGG - Intergenic
1075560352 10:123463720-123463742 GACCCTGTGCTGGAAGAGCTGGG - Intergenic
1075963075 10:126585956-126585978 GACCTAGTGCTGTAAGCAACAGG + Intronic
1078623544 11:12931965-12931987 GACCCACTGCTGTAAGAGATTGG + Intronic
1083951527 11:65959225-65959247 GCCCCAGTGCTGACAGCACCTGG - Exonic
1087453493 11:98353712-98353734 GCCCAAGTGCTGTCACAACCCGG - Intergenic
1088102634 11:106171951-106171973 GTCCCAATGCTGGAAGAACTTGG - Intergenic
1091003605 11:131932011-131932033 CAGCCAGGGCTGTCAGAACCAGG + Intronic
1091407616 12:219060-219082 CACCTATTGGTGTAAGAACCCGG - Intergenic
1092037307 12:5347960-5347982 GAACCAGTGAAGTAAGAACTTGG + Intergenic
1093097288 12:14985707-14985729 TACCCAGTGCTGAAACAAACAGG - Intergenic
1093108145 12:15114737-15114759 GACCCAGTGCTGTAAGAACCTGG - Intronic
1097098963 12:56572694-56572716 CACCCACTCCTGTAAGACCCTGG - Intronic
1097785928 12:63758750-63758772 CACTGAGTGCTGTAAGAACCAGG - Intergenic
1101323719 12:103696525-103696547 GACTTAGTCCTGTAAGAAACAGG + Intronic
1103716158 12:122946566-122946588 GACCCTGTGCTGGAAGAGCAGGG + Intronic
1104642189 12:130474632-130474654 GAACCAGTTCTGCAACAACCTGG + Intronic
1108034694 13:46277398-46277420 GTACCAGTTCTCTAAGAACCTGG - Intergenic
1113637326 13:111928721-111928743 CACCCGGTGCTCTGAGAACCGGG + Intergenic
1113812463 13:113150898-113150920 CACCCAGTGCGGCAGGAACCAGG - Intergenic
1115812649 14:37127047-37127069 AACCCAGTGCTCTCAGAACCAGG - Intronic
1116193997 14:41698595-41698617 GATCCAGTGCTGTAGGCACATGG + Intronic
1126795613 15:52258423-52258445 GACCCAGAGTTGGAAAAACCTGG - Intronic
1129183484 15:73891706-73891728 GACCAGGTGCTGTCACAACCCGG + Intergenic
1130652129 15:85768145-85768167 GACCCAGAGGTGTAAGACTCTGG - Exonic
1132978951 16:2725082-2725104 GACCAGGTGCTGTTGGAACCTGG + Intergenic
1140807967 16:78551400-78551422 GACCCAGTGTTGTAAGGAAATGG + Intronic
1140903423 16:79391168-79391190 AACCCAGTGCTCTAAGACCTTGG + Intergenic
1148080792 17:44966932-44966954 CAGCCAGGGCTGTAAGCACCGGG + Intronic
1148352758 17:46952282-46952304 GACCCAGTCCTGCATGGACCAGG - Intronic
1148482526 17:47969594-47969616 TACCCAGCGCTGTGAGATCCTGG + Intronic
1149870252 17:60174547-60174569 AACCCAGGCCTATAAGAACCTGG - Intergenic
1151206965 17:72514988-72515010 GACCCAGGGCTGAAATAACAGGG - Intergenic
1157506188 18:48228396-48228418 GACCCAGTGCTGTCTGTGCCAGG - Intronic
1157996053 18:52557433-52557455 GAGCCAGCGCTGTGAAAACCAGG + Intronic
1162549206 19:11349141-11349163 GAAGCAGTGCTGTAATGACCAGG + Intronic
1163027302 19:14519657-14519679 GACCCAGTGCAGACAGGACCTGG - Intronic
1164533732 19:29068144-29068166 AACCCAGAGTTGTCAGAACCTGG - Intergenic
1166210985 19:41306463-41306485 GAACCAGTACTATCAGAACCAGG + Exonic
1167135132 19:47611095-47611117 GACCCAGGGCTGTGTGACCCTGG - Intronic
1167741259 19:51326187-51326209 GACCCAGTGGGGTAAGATCCAGG - Intronic
925987442 2:9227637-9227659 GAACAAGAGCTGTAAGATCCTGG - Intronic
926251514 2:11157671-11157693 GACTCAGTGCTCTCAAAACCAGG - Intronic
927778744 2:25922684-25922706 AACCCATTGCTGTAAGAGTCTGG + Intergenic
928451974 2:31385675-31385697 GCCCCAGTGCTGTAAGAGATGGG - Intronic
929093545 2:38242916-38242938 TACCCTGTGCTGTGAGATCCTGG - Intergenic
929787670 2:45004053-45004075 GACACAGTGCTCTAGGAACTCGG + Intergenic
929962297 2:46506047-46506069 TTCCCAGTGCTGTCAGTACCAGG + Intronic
939040400 2:137182216-137182238 GACCCTGTGCTTTAGGAACTTGG + Intronic
945693083 2:213066422-213066444 GACCCAGGGATGTTTGAACCTGG - Intronic
1168848289 20:959795-959817 GACCCTGAGCTGTGAGCACCTGG - Exonic
1169091630 20:2864540-2864562 GCCCCAGTTCTGTAAGCATCAGG + Exonic
1169951596 20:11050107-11050129 GACCCAGTTATTTAACAACCTGG - Intergenic
1172128956 20:32643100-32643122 GGCCCAGTGCTGTGAGAATGTGG + Intergenic
1173231988 20:41205592-41205614 GACCGGCTGCTGTAAGAGCCAGG + Intronic
1174533058 20:51230004-51230026 GACCCAAAGGTGAAAGAACCAGG + Intergenic
1174768625 20:53276810-53276832 GAACCATTGCTTTAAGTACCTGG + Intronic
1180069328 21:45428239-45428261 GACGCAGCGCTGTGGGAACCGGG + Intronic
1180728316 22:17962422-17962444 GACCCAGGGCTCTTAGAGCCGGG + Intronic
1181925848 22:26357971-26357993 GGCTCAGGGCTGTGAGAACCAGG - Intronic
950183049 3:10928437-10928459 CCCCCAGTGCCATAAGAACCAGG + Intronic
950441133 3:13011216-13011238 GACACAGGGCTGAAAGACCCAGG + Intronic
956538343 3:70304995-70305017 GAGCCAGTGCTGCAAAAATCTGG - Intergenic
957602579 3:82357114-82357136 GACCGAATCCCGTAAGAACCTGG - Intergenic
974043210 4:56875783-56875805 GACTTAGTGCTCTTAGAACCTGG + Intergenic
974920435 4:68232677-68232699 TATTCAGTGCTGTAAGAAGCTGG + Intronic
980203563 4:129687989-129688011 AACGCAATGCTTTAAGAACCTGG + Intergenic
983749984 4:171256164-171256186 TAGCCAGTGCTGGTAGAACCTGG + Intergenic
983946275 4:173589432-173589454 GAAACAGTGCTGAAATAACCAGG + Intergenic
984137212 4:175955801-175955823 GATCCAGTGTTGTATGAAGCAGG + Intronic
984700113 4:182813812-182813834 GACCCAGTGCTCTGAGAAGCTGG - Intergenic
985528399 5:419673-419695 GTCCCTGTGCAGTAAGAGCCGGG - Intronic
986825887 5:11522284-11522306 GACCCTGGGCTGGAAGACCCAGG + Intronic
987026252 5:13929742-13929764 AACCCAGGGATGTCAGAACCTGG - Intronic
992841966 5:80704120-80704142 GACCCAGTGCTGATAGACCCCGG - Intronic
999241712 5:150131817-150131839 GACCCACTGCCGTGTGAACCTGG - Intronic
999985195 5:156997077-156997099 GACCCAGTGCTGTTTATACCTGG + Intergenic
1001034825 5:168290286-168290308 CACCCTGTGCTGTATGGACCAGG - Intergenic
1007058354 6:38911810-38911832 GACCCAGAGTTGAAAGAGCCAGG - Intronic
1009425876 6:63513094-63513116 GACCCAGAGAAGAAAGAACCTGG - Intergenic
1010966482 6:82215086-82215108 CCCACAGTACTGTAAGAACCAGG - Intronic
1016711425 6:147176929-147176951 GACCCAGGTATGAAAGAACCTGG - Intergenic
1018143024 6:160858718-160858740 AACACCGTGCTGTAACAACCAGG + Intergenic
1018816065 6:167332222-167332244 AACCCCGTGCTGTAACAAACAGG - Intronic
1020125278 7:5529901-5529923 GACCCGGCGCTGTTTGAACCGGG - Intronic
1022402016 7:30047528-30047550 GACCCACTCCTGTCAGAACTGGG - Intronic
1022477356 7:30720251-30720273 AGCTCAGTGCTGTAGGAACCAGG + Intronic
1026338512 7:69415176-69415198 AGCCCAGTGCTGTATGGACCAGG - Intergenic
1029999703 7:105046296-105046318 GAAGCAGTGATGTAAAAACCTGG - Intronic
1041122106 8:54596960-54596982 GACACAGTGCTGACAGAAACCGG - Intergenic
1045471581 8:102517490-102517512 GACCCAGAGTGGGAAGAACCAGG - Intergenic
1046317879 8:112530959-112530981 GCCCCAGTGCTGCAATGACCTGG + Intronic
1047716928 8:127604167-127604189 GACACAGTGCTGCTAGGACCAGG - Intergenic
1050092619 9:2030378-2030400 GTTCCAGTGATGTGAGAACCAGG + Intronic
1051958120 9:22723409-22723431 GACCCAGGGCTTTAAGAAGCAGG + Intergenic
1059435376 9:114272885-114272907 GAGTCAGTGCTGTGTGAACCTGG - Intronic
1186770263 X:12811317-12811339 CACCCAGTGGTGTGAGAACGTGG + Intronic
1190575932 X:51838156-51838178 GTCTCAGTGCTGTAATACCCTGG + Intronic
1195634092 X:107093422-107093444 GATCCACTACTGTAAGAAACGGG + Intronic
1200246561 X:154529691-154529713 GACCCAGTGCTGTCCTCACCTGG + Intergenic