ID: 1093108365 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:15117659-15117681 |
| Sequence | TGTGTGCGCGTGTGTGATGG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 3698 | |||
| Summary | {0: 1, 1: 0, 2: 45, 3: 819, 4: 2833} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1093108365_1093108367 | 11 | Left | 1093108365 | 12:15117659-15117681 | CCTCCATCACACACGCGCACACA | 0: 1 1: 0 2: 45 3: 819 4: 2833 |
||
| Right | 1093108367 | 12:15117693-15117715 | ACACACACACACACAGTCACAGG | 0: 7 1: 48 2: 1856 3: 3889 4: 7081 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1093108365 | Original CRISPR | TGTGTGCGCGTGTGTGATGG AGG (reversed) | Intronic | ||