ID: 1093108365

View in Genome Browser
Species Human (GRCh38)
Location 12:15117659-15117681
Sequence TGTGTGCGCGTGTGTGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3698
Summary {0: 1, 1: 0, 2: 45, 3: 819, 4: 2833}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093108365_1093108367 11 Left 1093108365 12:15117659-15117681 CCTCCATCACACACGCGCACACA 0: 1
1: 0
2: 45
3: 819
4: 2833
Right 1093108367 12:15117693-15117715 ACACACACACACACAGTCACAGG 0: 7
1: 48
2: 1856
3: 3889
4: 7081

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093108365 Original CRISPR TGTGTGCGCGTGTGTGATGG AGG (reversed) Intronic