ID: 1093109461

View in Genome Browser
Species Human (GRCh38)
Location 12:15131922-15131944
Sequence CTTAAACATATGGAGAACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 174}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093109453_1093109461 6 Left 1093109453 12:15131893-15131915 CCTTTACACCCCATAAGAAGACA 0: 1
1: 0
2: 1
3: 10
4: 149
Right 1093109461 12:15131922-15131944 CTTAAACATATGGAGAACCAGGG 0: 1
1: 0
2: 1
3: 10
4: 174
1093109452_1093109461 16 Left 1093109452 12:15131883-15131905 CCTATGGCTACCTTTACACCCCA 0: 1
1: 0
2: 1
3: 4
4: 94
Right 1093109461 12:15131922-15131944 CTTAAACATATGGAGAACCAGGG 0: 1
1: 0
2: 1
3: 10
4: 174
1093109455_1093109461 -2 Left 1093109455 12:15131901-15131923 CCCCATAAGAAGACAGGAAGCCT 0: 1
1: 0
2: 1
3: 19
4: 344
Right 1093109461 12:15131922-15131944 CTTAAACATATGGAGAACCAGGG 0: 1
1: 0
2: 1
3: 10
4: 174
1093109450_1093109461 28 Left 1093109450 12:15131871-15131893 CCAAACACCACTCCTATGGCTAC 0: 1
1: 0
2: 1
3: 8
4: 94
Right 1093109461 12:15131922-15131944 CTTAAACATATGGAGAACCAGGG 0: 1
1: 0
2: 1
3: 10
4: 174
1093109456_1093109461 -3 Left 1093109456 12:15131902-15131924 CCCATAAGAAGACAGGAAGCCTT 0: 1
1: 0
2: 1
3: 14
4: 178
Right 1093109461 12:15131922-15131944 CTTAAACATATGGAGAACCAGGG 0: 1
1: 0
2: 1
3: 10
4: 174
1093109457_1093109461 -4 Left 1093109457 12:15131903-15131925 CCATAAGAAGACAGGAAGCCTTA 0: 1
1: 0
2: 2
3: 7
4: 191
Right 1093109461 12:15131922-15131944 CTTAAACATATGGAGAACCAGGG 0: 1
1: 0
2: 1
3: 10
4: 174
1093109451_1093109461 21 Left 1093109451 12:15131878-15131900 CCACTCCTATGGCTACCTTTACA 0: 1
1: 0
2: 1
3: 10
4: 124
Right 1093109461 12:15131922-15131944 CTTAAACATATGGAGAACCAGGG 0: 1
1: 0
2: 1
3: 10
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093109461 Original CRISPR CTTAAACATATGGAGAACCA GGG Intronic
900896504 1:5486617-5486639 CTTTCACACATGGAGAATCAGGG + Intergenic
901964057 1:12851653-12851675 CTTAAAATTAAGGATAACCAAGG - Intronic
901970105 1:12901660-12901682 CTTAAAATTAAGGATAACCAAGG - Intronic
901991706 1:13120290-13120312 CTTAAAACTAAGGATAACCAAGG - Intergenic
902015066 1:13300121-13300143 CTTAAAATTAAGGATAACCAAGG + Intergenic
903787694 1:25872306-25872328 CTTTGACATTTGGAGAAACAGGG - Intergenic
905258600 1:36701600-36701622 CTCCAACATTTGGAGATCCAAGG - Intergenic
912066822 1:105755393-105755415 ATTACACAAATGGAGAATCATGG + Intergenic
916194705 1:162212223-162212245 GTTTGACATATAGAGAACCAGGG + Intronic
916859491 1:168787639-168787661 ATAAAACATATGGAGAAATAGGG - Intergenic
917766656 1:178227041-178227063 CTTTAACATGTGGAGAACTCAGG - Intronic
917998191 1:180463155-180463177 CTAAAAGAAATAGAGAACCAAGG + Intronic
920405473 1:205706029-205706051 GTTATACATATTGAGAAGCAAGG - Intergenic
1063068236 10:2631833-2631855 CTTAAACACACAGAGGACCAGGG - Intergenic
1067999650 10:51317478-51317500 TTTACACATAAGGAGAGCCAAGG - Intronic
1069111188 10:64448956-64448978 CTTAACCATCTGGAAAAACAAGG + Intergenic
1069450330 10:68512252-68512274 CTTAAATATTTGGAGAGACAAGG - Intronic
1070506322 10:77116396-77116418 GTTAAACATATAGAGGACAAAGG - Intronic
1072504047 10:96046266-96046288 CTTAAACATAAAGACAACCCAGG - Intronic
1073959503 10:108910589-108910611 GTTAAACATTTGAGGAACCAAGG - Intergenic
1074513526 10:114141757-114141779 GTTCAAAATATGGGGAACCAAGG - Intronic
1075267920 10:121020962-121020984 CTTAAACATATGGAGAAATAGGG + Intergenic
1076125346 10:127969781-127969803 ATTATACATCTGGAGAATCATGG + Intronic
1079042404 11:17070975-17070997 CTTAAGCACATGGAAAAACAAGG + Intergenic
1080040527 11:27754883-27754905 CTTAAACAGATGCAGAAAGAGGG + Intergenic
1080476772 11:32601884-32601906 CTTAAATGTTTAGAGAACCAAGG + Intronic
1086509305 11:87539464-87539486 TTAAAACATATTGAGAAGCATGG + Intergenic
1088773471 11:113058975-113058997 ATGAAATACATGGAGAACCAAGG - Intronic
1089236705 11:117033985-117034007 ATTAAACATATGAAGAACGTGGG - Intronic
1090460160 11:126884134-126884156 CTTATACACACTGAGAACCACGG - Intronic
1091795375 12:3294883-3294905 GTTACAGAGATGGAGAACCATGG + Intergenic
1092150898 12:6247680-6247702 TCTTAACATATGGAGAAACAGGG + Intergenic
1093109461 12:15131922-15131944 CTTAAACATATGGAGAACCAGGG + Intronic
1093394814 12:18668440-18668462 CCTACACACATGGAGCACCAAGG + Intergenic
1093430325 12:19078003-19078025 CTTAATCATATGGAGACTAAGGG + Intergenic
1094652803 12:32394027-32394049 CATAAACATATTTAGTACCATGG - Intergenic
1095313724 12:40732283-40732305 ATTTAACATGTGGAGAACTAAGG + Intronic
1097716833 12:62975756-62975778 CTTAAACAGATGAAAAACTAAGG + Intergenic
1099967742 12:89468696-89468718 CTTAAATATATGCATATCCATGG - Intronic
1102144032 12:110640909-110640931 CTTCAACACATGGAGAAACAGGG + Intronic
1102190014 12:110980677-110980699 CTTCCACATATGCAGAAACAAGG - Intergenic
1103762522 12:123261912-123261934 CTCAGACATAAAGAGAACCAGGG + Intronic
1107361218 13:39619364-39619386 ATTAAACATATCTACAACCAAGG + Intergenic
1107691717 13:42960172-42960194 CTCAAACATATGTAGATCGAAGG + Intronic
1107964950 13:45589675-45589697 CTTAAAGATATTGAGAACTGGGG - Intronic
1108400411 13:50036265-50036287 CTTACCCATATGGATAACAACGG + Intergenic
1108694066 13:52887259-52887281 CTTGAACATATGCTGAACAAGGG + Intergenic
1109042893 13:57363483-57363505 CTAAAACATATTGAGAACTTGGG + Intergenic
1110716093 13:78705927-78705949 CAAAAACATATGGAGTAGCATGG + Intergenic
1112674075 13:101677856-101677878 GTCAAACATATGCAGAACCTGGG - Intronic
1116765069 14:49060219-49060241 ATTTTACATATGGAGAACAAAGG + Intergenic
1124024645 15:25954160-25954182 CTTAAAGATATGGAGATATATGG - Intergenic
1124029982 15:26001697-26001719 CTTTATCATAAGGAGAAACACGG - Intergenic
1125973261 15:43929537-43929559 CTTTAACAGATTGTGAACCAAGG - Intronic
1127100207 15:55556579-55556601 CTAAAAGAACTGGAGAACCAAGG + Intronic
1130231168 15:82098139-82098161 CTTAAAAATATGCATAACCAGGG - Intergenic
1134762169 16:16724017-16724039 CTTAATCATATGCTAAACCAGGG - Intergenic
1134983891 16:18635153-18635175 CTTAATCATATGCTAAACCAGGG + Intergenic
1137264088 16:46854404-46854426 CTCAAACAAATGGAAACCCAAGG + Intergenic
1138482252 16:57311197-57311219 CTGAAACCTTTGGAGAACAAAGG - Intergenic
1138814116 16:60184464-60184486 CTGAAAGCCATGGAGAACCAAGG + Intergenic
1143426733 17:6845414-6845436 TTTAAACATTTGGAGATCCTGGG - Intergenic
1149012861 17:51875348-51875370 CCTAGACTGATGGAGAACCATGG + Intronic
1155736177 18:29225024-29225046 AATAAAAATATGGAGAACTATGG - Intergenic
1156677740 18:39550904-39550926 CTCCAACACATGGAGAAACATGG + Intergenic
1158256872 18:55560958-55560980 TTTGAACATATTCAGAACCATGG - Intronic
1159644436 18:70900693-70900715 CTTTCACATAAGGAGATCCAGGG + Intergenic
1162204552 19:9046029-9046051 CTGACATATATGCAGAACCATGG - Intergenic
1162578571 19:11513803-11513825 CTGGAGCAGATGGAGAACCACGG - Exonic
1163975797 19:20850729-20850751 CTACAACATATGCAGAGCCATGG - Intronic
1164829899 19:31312330-31312352 CTTAAACATATATAGCCCCATGG - Intronic
1167068050 19:47201931-47201953 CTAAAATACATGGAGAACTAGGG - Intronic
926514931 2:13831445-13831467 CTTAAAAATATGGCCAACAAGGG + Intergenic
927014467 2:18943675-18943697 ATTAAAAATATGTAGAAACATGG - Intergenic
927229927 2:20811965-20811987 GGTAATGATATGGAGAACCAGGG + Intronic
928796380 2:35026384-35026406 AATAAACATAGGGAAAACCATGG + Intergenic
929809054 2:45173053-45173075 CTTAAACATGTTGAGAAAGAAGG + Intergenic
929979836 2:46667985-46668007 CTGAACCATCCGGAGAACCAGGG - Intergenic
930278718 2:49343717-49343739 ATTAAAGATATTAAGAACCATGG + Intergenic
930951604 2:57149640-57149662 CTAAAACAACTAGAGAACCAAGG + Intergenic
932579922 2:72986424-72986446 CTTTTACAGATGGAGAAGCAGGG + Intronic
937818370 2:126279169-126279191 CTAAACCAGATGGAGCACCAGGG - Intergenic
939666596 2:144960342-144960364 CGGAAACAAATGGAGAGCCAGGG + Intergenic
940722352 2:157295922-157295944 CTTAAATAAATGGAAAAACATGG + Intronic
941001770 2:160209518-160209540 CTGAAACAGCTGGAGAACCCTGG - Intronic
941389353 2:164892088-164892110 CTTAAACATTTAGAAAAACAGGG - Intergenic
942708383 2:178802686-178802708 CTTATAAAAATGAAGAACCAAGG + Intronic
943607800 2:189997025-189997047 ATTAAACATATCTACAACCAAGG - Intronic
944712787 2:202350281-202350303 CTTAAACATTTGTAGAAGCCAGG - Intergenic
1169352436 20:4880126-4880148 CTAATACAAAAGGAGAACCATGG - Intronic
1173328615 20:42055675-42055697 CTTAGACAAAGGGAGGACCATGG + Intergenic
1173505901 20:43586916-43586938 CTTGAACATATGGAGCTCCATGG - Intronic
1177512924 21:22113426-22113448 ATCAAACATATGGAGTCCCAAGG - Intergenic
1178464139 21:32831610-32831632 CCAAAACATATGGAGGACAAGGG - Intergenic
1181559268 22:23690650-23690672 CTTGTGCATATGGAGAACCTGGG - Intronic
951610545 3:24487965-24487987 CTGAACCATCTTGAGAACCAAGG + Intronic
954228901 3:49200960-49200982 CTTAGACATATTGAGAATAAGGG + Intronic
955934395 3:64088960-64088982 CATAAACATTTGGAGATCTAGGG - Intergenic
957180055 3:76865578-76865600 CTTAAAAGTATGGATCACCAAGG + Intronic
957339866 3:78882027-78882049 TTTAAAAAAATGGAGAAACAAGG - Intronic
960322381 3:116252121-116252143 CTTAAACACATGGGAGACCAAGG + Intronic
963383916 3:144566920-144566942 CTTAAAAATATAGCAAACCAAGG + Intergenic
965635512 3:170776390-170776412 CCTATAGATATGGAGAGCCATGG + Intronic
968237587 3:197045044-197045066 CATAAACATATGTAGAAAAAAGG + Intronic
970084244 4:12327891-12327913 CTAAAACATATTGAAAAGCAGGG - Intergenic
970706335 4:18808028-18808050 CTTAAACATTTTGAAAAACATGG + Intergenic
970815870 4:20155801-20155823 TTGAAACATCTGAAGAACCAGGG + Intergenic
971293526 4:25368270-25368292 ACTCAACATATTGAGAACCAAGG - Intronic
971549587 4:27934450-27934472 CTAAAACATTTGAAGAACAATGG + Intergenic
971838167 4:31796581-31796603 GTTCAACATATGCAAAACCAGGG - Intergenic
972046451 4:34670786-34670808 AGAAAACATATGGAGAAGCAGGG + Intergenic
973278292 4:48333002-48333024 GTTAAACAAATGGAGAAGGAGGG - Intergenic
974434661 4:61841216-61841238 CTTAAACATTTGAAAATCCAAGG + Intronic
974771476 4:66420136-66420158 CATAAAAATATTGAGAATCAGGG + Intergenic
976045286 4:80939706-80939728 TTTAAAAATATGAAGAATCAAGG - Intronic
977430371 4:96925221-96925243 TTTGACCATGTGGAGAACCAAGG + Intergenic
977710165 4:100115503-100115525 ATTAAACAAATGGAGATTCAGGG + Intergenic
980764088 4:137275994-137276016 CTTAAACAAATGTAGACCCTTGG - Intergenic
980778804 4:137469973-137469995 AATAAAGATATGCAGAACCATGG + Intergenic
981916067 4:150034565-150034587 CTTAAATATATGCACAACCATGG + Intergenic
982954340 4:161743394-161743416 CTAAAACATATGTAGACCAATGG - Intronic
987434291 5:17875191-17875213 ATTCAGGATATGGAGAACCATGG + Intergenic
987863413 5:23511941-23511963 TTTAAACATATAGAAAACAATGG - Intronic
991352102 5:65729813-65729835 ATTAAAGATATGAAGAACCAAGG + Intronic
991391332 5:66146476-66146498 CTTAAACATATGGAAGATTACGG + Intronic
992242507 5:74786568-74786590 TTTGACCATATGGAGAACCAAGG + Intronic
993109214 5:83634898-83634920 CTTAACCTCATGGAAAACCATGG - Intergenic
993277179 5:85875283-85875305 TTTAAACCTATGGAGAAAGAAGG + Intergenic
994506024 5:100643836-100643858 CTTAAATATATGAAGAACTCAGG + Intergenic
994947225 5:106410485-106410507 GGGAAACATATGGATAACCAGGG - Intergenic
995702546 5:114952755-114952777 CTAATACATCTGGAGAACCCAGG - Intergenic
997729708 5:136159039-136159061 ATTAAACAAATGAAGAAACAAGG + Intronic
1000871631 5:166584310-166584332 TTTAAATTTCTGGAGAACCAGGG - Intergenic
1003464281 6:6363671-6363693 GCTAAAAATATGGAGGACCATGG + Intergenic
1005531781 6:26714507-26714529 ATTCAGCATATGAAGAACCAGGG + Intergenic
1005539014 6:26787158-26787180 ATTCAGCATATGAAGAACCAGGG - Intergenic
1010432901 6:75799030-75799052 CTTAAAAATATAGCTAACCAAGG + Intronic
1011154522 6:84315298-84315320 TTAAAACATATTGAGAAACAAGG + Intergenic
1011906157 6:92370912-92370934 TTTAAACATATCAAGAAACAGGG + Intergenic
1012631687 6:101477570-101477592 CTTAACCATATGGTGAGGCAGGG + Intronic
1012837632 6:104290363-104290385 TTTAAACATATGGAGATATATGG - Intergenic
1015395961 6:132735124-132735146 CTTAGACGGATGGAGAACAAGGG - Intergenic
1017790368 6:157792739-157792761 CTTAATAATATGAAGGACCAGGG - Intronic
1018232179 6:161686225-161686247 CTTATAAAAATGGAGAACCATGG - Intronic
1020854129 7:13395652-13395674 CAGAAACATATACAGAACCATGG - Intergenic
1024337812 7:48227029-48227051 CTTAAAAATATGGACAAGGAGGG - Intronic
1026214294 7:68334580-68334602 CCTAAAGAAATGGAGAGCCAGGG - Intergenic
1027153210 7:75747749-75747771 CCCAAACATCTGGAGAAACATGG - Intergenic
1027579314 7:79974043-79974065 TATAAACATATGGAAACCCATGG - Intergenic
1031316289 7:120261470-120261492 TTCAAACAGAGGGAGAACCAAGG + Intergenic
1034051120 7:147985320-147985342 CATGTACATGTGGAGAACCAAGG - Intronic
1037232826 8:16680262-16680284 TTTGAACATCTGGAGAACCAGGG - Intergenic
1037875085 8:22541014-22541036 CTTAAAATTATGGAGAAAAAAGG - Exonic
1040514178 8:48120941-48120963 CTTAAAAATAAGGTGAAACAAGG + Intergenic
1045571790 8:103375128-103375150 CTTAAAAACAGGGAGAAGCAGGG + Intronic
1045682359 8:104676388-104676410 CTTATCCATATGGAGAAGAAGGG + Intronic
1046972764 8:120240730-120240752 CTTAAACATATGTAAAACAAGGG + Intronic
1047382476 8:124376020-124376042 ATTAAACAGATGGGCAACCACGG - Intergenic
1047728702 8:127707484-127707506 CTGGTACATATGGAGGACCATGG + Intergenic
1048025461 8:130582597-130582619 CCTAAACATGGGGAGAACCTAGG + Intergenic
1051494352 9:17702480-17702502 TTTAAACAGATGGAAAAGCAAGG + Intronic
1051705972 9:19880255-19880277 CATTAACACATGGAGAACCAGGG + Intergenic
1053116516 9:35508973-35508995 CTTGAAAATTTGGAAAACCAAGG + Intronic
1053304060 9:36971560-36971582 CTTAAATATATGGACAGACACGG + Intronic
1056026705 9:82505004-82505026 ACTAAACATATGTACAACCAAGG + Intergenic
1056298347 9:85216547-85216569 CATTAACCTATGCAGAACCATGG + Intergenic
1058690692 9:107518046-107518068 CTGAATCATAGGGAGGACCAGGG - Intergenic
1058761268 9:108135561-108135583 TATAAACACATGGAGAGCCAGGG + Intergenic
1059364545 9:113775957-113775979 CGTACTCATGTGGAGAACCAGGG + Intergenic
1062369668 9:136231435-136231457 CTTCAACATGTAGAAAACCAAGG + Intronic
1187272396 X:17791175-17791197 CTTACACATAGGGTGAAGCAGGG + Intergenic
1187880433 X:23842092-23842114 CATAAACAAATGGAAAGCCAGGG + Intronic
1189128397 X:38472773-38472795 TTAAATCATATGGAGAACTAAGG + Intronic
1189945754 X:46176621-46176643 CTTACACAACTGGAGAAACAAGG - Intergenic
1192074609 X:67980255-67980277 CTTAAGCATATAGAGATACAAGG - Intergenic
1193989999 X:88294959-88294981 TTTAAAAATATGGATAACCCTGG + Intergenic
1195235590 X:102894346-102894368 CTTACTCATGAGGAGAACCAAGG + Intergenic
1196087428 X:111699870-111699892 CTTAAATTTATATAGAACCACGG - Intronic
1197183201 X:123559492-123559514 ATTAAACAGTTGGAGAACTACGG + Intergenic
1198921997 X:141739430-141739452 GTGGAACATATGGAAAACCAAGG + Intergenic
1199167669 X:144696554-144696576 TTTAAACATCTAGAGAACAAAGG - Intergenic
1199294772 X:146144650-146144672 CAGAAAAATTTGGAGAACCAAGG + Intergenic
1199493123 X:148423186-148423208 CATAAACAAAAGGAAAACCATGG - Intergenic
1199824963 X:151489598-151489620 CTTAAACAGCTGGATAGCCAGGG + Intergenic
1202341413 Y:23872900-23872922 TTGACATATATGGAGAACCAAGG - Intergenic
1202529353 Y:25797186-25797208 TTGACATATATGGAGAACCAAGG + Intergenic