ID: 1093115669

View in Genome Browser
Species Human (GRCh38)
Location 12:15207789-15207811
Sequence TTTTGTGAAGGGCTGTCATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 182}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093115669 Original CRISPR TTTTGTGAAGGGCTGTCATA AGG Intronic
901347173 1:8555593-8555615 TTTTGTTAAGTACTGTAATATGG - Intronic
901429621 1:9205225-9205247 TTTTTTGAAGGGTTATAATATGG + Intergenic
903125087 1:21242364-21242386 TTTTGTGAATGGCCTTCATTCGG - Intronic
903998470 1:27323008-27323030 TTTTGGGAGGAGCTCTCATATGG + Intronic
904757935 1:32779435-32779457 GTTTGTGAAGGGCTATGAAAAGG - Exonic
905485125 1:38290637-38290659 TTTTGAGAAGGGCTGGCTTATGG - Intergenic
906256689 1:44355789-44355811 ATTTGTGAAGGGCCGTCCTAAGG + Intergenic
908043701 1:60144956-60144978 TTGTGTGAACTGCTGTCATGTGG - Intergenic
910606299 1:89088607-89088629 ATTTGAGTAGGGCTGTCACATGG + Intergenic
911097732 1:94068911-94068933 TATTGTCATTGGCTGTCATAGGG - Intronic
912537240 1:110383780-110383802 TTTTGGAAAGGGCTGTTAAAAGG + Intronic
912838034 1:113014069-113014091 GTGTGTGAAGGGTTGTCATATGG - Intergenic
916347001 1:163804318-163804340 TCCAGTGAAGGGCTGTCACAGGG - Intergenic
917487579 1:175468852-175468874 ATTTCTGAAGGGCTCTCATAAGG + Intronic
917623958 1:176827074-176827096 TTTTGTGAAGGAAAGTCATCAGG - Intronic
918404307 1:184196266-184196288 GTATGTGAAGGGCTTTGATAGGG + Intergenic
920802557 1:209202920-209202942 TTCTGAGAAGGGCTGGCATTAGG - Intergenic
921037145 1:211391474-211391496 TGTTGTGAAGGGCTTTCCTATGG - Intergenic
921314194 1:213875139-213875161 TATTGGGGAGTGCTGTCATAAGG - Intergenic
922920524 1:229298685-229298707 CTTTCTGATGGGCTGTCATTTGG + Intronic
923467243 1:234260276-234260298 CTTCGTGAAAGGCTGCCATATGG + Intronic
923593606 1:235342479-235342501 TTTTGTGAAGATCTGACAGAGGG + Exonic
924091901 1:240509932-240509954 ATATTTGAAGGGCTGTCATGTGG + Intronic
1063786832 10:9394316-9394338 TTCTGGTAAGGGCTGTCATCAGG + Intergenic
1064146718 10:12831899-12831921 TTTCGTGAAGGTCTGACAAATGG + Exonic
1065159456 10:22904116-22904138 TTATGTGCAGAGCTGCCATATGG + Intergenic
1065817764 10:29497727-29497749 TATTGTGAAAGGCTGACTTAGGG + Intronic
1065856427 10:29834286-29834308 ATATTTGAAGGGCTGTCACAGGG + Intergenic
1065926973 10:30443391-30443413 ATTTTGGAAGGACTGTCATAAGG - Intronic
1070665070 10:78336979-78337001 ATCTCTGAATGGCTGTCATAAGG + Intergenic
1072630385 10:97141312-97141334 CTATGTGAAGGGCTGTCATGAGG - Intronic
1072767713 10:98109226-98109248 ATGTTGGAAGGGCTGTCATATGG - Intergenic
1073277710 10:102326910-102326932 GTTGGTGAAGGGCTTTCATCTGG + Intronic
1074784355 10:116826009-116826031 ATGTGTGAAGGGCTGTCACATGG + Intergenic
1075787579 10:125060638-125060660 TTATGTGCAGGGCAGTCATGCGG + Intronic
1078329026 11:10403448-10403470 TTTGGGGAAGAGCTGTCAAAAGG - Intronic
1079273370 11:19010110-19010132 TCTTGTGAAATGCTGTCAAAAGG + Intergenic
1080825599 11:35846427-35846449 TTCTGTGTGGGGCTGTAATATGG - Intergenic
1080862951 11:36166050-36166072 TTAGGTGAAGGGCTGACAGAGGG + Intronic
1083519453 11:63295134-63295156 TTTTATGAAGAGATTTCATAAGG + Intronic
1084080286 11:66818747-66818769 TTTTTTTAAGGTCTGTCAGAAGG + Intronic
1085239901 11:75044577-75044599 TTTTGGCAAGGGCTGACAGATGG - Intergenic
1086035262 11:82406994-82407016 GTATTTGAAGGGCTGTCATAAGG - Intergenic
1087264939 11:96050279-96050301 TGATGTGAAGGGCAGGCATAGGG + Intronic
1089073984 11:115722331-115722353 ATATTTGAAGAGCTGTCATATGG - Intergenic
1090577459 11:128122100-128122122 TTTTATGAATGCCTGTCATTGGG - Intergenic
1093115669 12:15207789-15207811 TTTTGTGAAGGGCTGTCATAAGG + Intronic
1095046560 12:37513773-37513795 TTTTGTGAAGGTTTTTCATCAGG - Intergenic
1095437277 12:42204100-42204122 TTGTGTGAAGTGGTGTCAGAAGG - Intronic
1096307050 12:50486923-50486945 TTTTGTGGAGAACTGTCAAATGG - Intergenic
1097778767 12:63679406-63679428 TATTTTGAAGGACTGTCATGTGG + Intergenic
1098968826 12:76826183-76826205 GTTTGTGAAGGGCTCTTACATGG + Intronic
1101806852 12:108071574-108071596 TGTAGTGAAGGGCCGCCATATGG + Intergenic
1103100510 12:118170447-118170469 TTTTGAGAAGGGCAGTGATATGG - Intronic
1103382662 12:120506689-120506711 TTTCTTGAAAGGCTGTGATAGGG - Intronic
1107213992 13:37893806-37893828 TGGTGGGAAGGGCAGTCATATGG + Intergenic
1107344591 13:39445292-39445314 TTGTGTGATGTGATGTCATATGG - Intronic
1108013737 13:46051752-46051774 GTTTGTGAAGGGTAGTCTTAAGG - Intronic
1108915676 13:55607694-55607716 TTTTGTGATGGGAAGACATAAGG + Intergenic
1111691776 13:91572758-91572780 TTTTGGGAAGGACTGTGATATGG - Intronic
1111785636 13:92783377-92783399 TATTGTGAAGAAATGTCATAAGG + Intronic
1112878084 13:104070268-104070290 ATTTTTGACAGGCTGTCATAGGG + Intergenic
1115305602 14:31930568-31930590 TTTGGTGAAGTTTTGTCATAGGG - Intergenic
1117436787 14:55722858-55722880 GTTTGGGAAGGGCTGCCATGTGG - Intergenic
1120392176 14:83923412-83923434 TTTTGAGAAGGGGTCTCACATGG - Intergenic
1120845502 14:89121610-89121632 TTCAGTGAATGGCTGTCAAATGG - Intergenic
1122142762 14:99672724-99672746 TTGTGGGAGGGGCTGGCATATGG + Intronic
1126203270 15:46014281-46014303 TTTTTGGATTGGCTGTCATAGGG + Intergenic
1126224171 15:46250786-46250808 TTTTCTGAAGGGTTTTTATATGG - Intergenic
1128467368 15:67924253-67924275 ATATGTAAAGAGCTGTCATATGG + Intergenic
1130217111 15:81982759-81982781 TTTTGGGAGGGGATGACATAAGG - Intergenic
1130858949 15:87868863-87868885 TTTTGTGCAGGTCTTTCCTATGG - Intronic
1134036488 16:11035262-11035284 TTTTTTGCACAGCTGTCATATGG + Intronic
1134054279 16:11159558-11159580 GTTTGAAAAGGGCTGTCATAGGG + Intronic
1135851499 16:25968004-25968026 ATATGTGAAGGGTTGTCATGGGG + Intronic
1136497473 16:30653008-30653030 TTTTGTGAAGGGCCCTCCTCTGG - Exonic
1136933860 16:34440764-34440786 TTATGTAAAGGGCTGGCAAAGGG - Intergenic
1136970712 16:34971050-34971072 TTATGTAAAGGGCTGGCAAAGGG + Intergenic
1138366546 16:56483312-56483334 ATTTGACAAGGGCTGTCCTAGGG - Intronic
1140253129 16:73312265-73312287 ATATTTGGAGGGCTGTCATAAGG + Intergenic
1140671582 16:77284796-77284818 GATTGAGAAGGGCTGTCAGAGGG + Intronic
1142242216 16:88952762-88952784 AATTGTGATGGGCTGTCATGGGG - Intronic
1146414939 17:32623032-32623054 ATTTGTGAAAGGCTATCAGAGGG + Intronic
1148855911 17:50579258-50579280 ATATTTGAAGGGCTGTCATGTGG + Intronic
1149307315 17:55360935-55360957 TTTTTTGAAGAGCTCTCATGTGG + Intergenic
1149902734 17:60495642-60495664 TTTTTTGAAGTGTTGTCATGAGG + Intronic
1152086973 17:78226177-78226199 TTGTCAGAAAGGCTGTCATATGG + Intergenic
1153212509 18:2783316-2783338 CTTTGAGAAGGGCTGTCCCAGGG + Intronic
1153493858 18:5677464-5677486 TGTTGTGAGGGGCTGTCCTGTGG - Intergenic
1153574968 18:6511118-6511140 TTTTGTGCACAGCAGTCATATGG - Intergenic
1155738900 18:29261101-29261123 TTATGTGACAGGCTGTCATGGGG - Intergenic
1156745835 18:40390021-40390043 TTTTGTAAATGGTTGTCATGAGG - Intergenic
1159150372 18:64515340-64515362 TTCTTTAAAGGGCTGTTATAAGG - Intergenic
1165187318 19:34033169-34033191 TTATGTGAAAGGCTGTCTAAGGG - Intergenic
1165251495 19:34540213-34540235 GTAAGTGAAGGGCTGTGATATGG - Intergenic
925172392 2:1758265-1758287 TTGTCTGCAGGGCTGTCGTATGG + Intergenic
925884304 2:8381284-8381306 TTCTGAGAAGGCCTGCCATAAGG - Intergenic
926674055 2:15604835-15604857 TTTTGTGTAGGGCAGTCAAAAGG + Intronic
928165910 2:28971685-28971707 TTTTCTGAAGGGCAGTCATGAGG + Intronic
928625203 2:33132872-33132894 TTATTTGAAGGGCTGTCATGTGG + Intronic
931789573 2:65652576-65652598 TGTTGTGGAGGGCTGTCCTGGGG - Intergenic
936630268 2:114194441-114194463 TTTTGTGGAGAGCTGGCATAAGG + Intergenic
937307652 2:120881977-120881999 TTTTGGGATGGAATGTCATAGGG + Intronic
940021456 2:149160459-149160481 TTTTGTGGAGGGATGTGATGAGG + Intronic
941183176 2:162286245-162286267 CTATGTGAAGGGCTGTCATTAGG + Intronic
942281479 2:174368321-174368343 CTTTGTTAAGGTGTGTCATATGG - Intronic
943200246 2:184813774-184813796 TATTTTGAATGGTTGTCATAGGG - Intronic
943256771 2:185603567-185603589 TTTAGTGAAGTGATGTCCTATGG - Intergenic
944685864 2:202117248-202117270 TTTTGTGATGGTCTGTGATTTGG + Intronic
945339352 2:208633146-208633168 TTATGTGCAGGTCTGTCACATGG + Intronic
945942001 2:215959681-215959703 CTGTGTGGAGGGCTGTCATTGGG - Intronic
947884808 2:233559603-233559625 TTTTATGAATGGCTGTGATTTGG - Intronic
948001455 2:234571192-234571214 TTATTTGAAGGGCTGCCATAGGG + Intergenic
948006595 2:234614343-234614365 TTTTTTGAAGGGATGGCAAAAGG - Intergenic
1170422292 20:16204988-16205010 TTTTATGAGGGGCTGTTAAAGGG - Intergenic
1171541123 20:25957403-25957425 TTTTGTGAAGGTTTTTCATCAGG - Intergenic
1171799945 20:29602936-29602958 TTTTGTGAAGGTTTTTCATCAGG + Intergenic
1172518770 20:35554058-35554080 CTTTGCAAAGGGCTGTCCTAAGG - Intronic
1173854343 20:46240494-46240516 TTTTGTGAAGGGCTCTGTCAAGG + Intronic
1179636302 21:42712651-42712673 TTTTGTGGATGCCTTTCATAAGG + Intronic
1182151599 22:28031029-28031051 TTCTGTTAAAGTCTGTCATAGGG - Intronic
1182807896 22:33091053-33091075 ATATTTGAAGGGCTGTCATGAGG - Intergenic
1183357546 22:37367687-37367709 TTTTGGGAAGGGAGGTCATCAGG + Intergenic
949871911 3:8596293-8596315 ATATCTGAAGGGCTGTCACAAGG + Intergenic
949954570 3:9257107-9257129 TTTTGTGTTGGGCTTTCATAGGG - Intronic
952156033 3:30644486-30644508 TTTTGTCAATGGTTGTCATAAGG - Intronic
953508830 3:43514450-43514472 TTTTTTGAAGCTCTGTCATTTGG - Intronic
954350880 3:50042838-50042860 TTTTGTGACTGCCTGTCAGAAGG - Intronic
954641162 3:52098853-52098875 TATTGGGAAGGGCCATCATAAGG - Intronic
960511855 3:118558901-118558923 TGTTGTGAAGGGCTATCTTTGGG + Intergenic
962016882 3:131450141-131450163 TATAATGAAGGGCTGTCAGATGG - Intergenic
962591269 3:136891594-136891616 TTTTTTGAAGAACTGCCATATGG + Intronic
963747790 3:149142842-149142864 TTTTGTTATAGGCTGTCACAGGG - Intronic
965861329 3:173154448-173154470 TTTTGTTAAGGGCAGTCCTAGGG + Intergenic
966238037 3:177724608-177724630 TTTTGTGAAGATCTTTCCTATGG + Intergenic
966657178 3:182372767-182372789 CTGTGTGAAAGGCTGTCAAAAGG - Intergenic
967824660 3:193868870-193868892 ATTTGCAAAGGTCTGTCATAGGG - Intergenic
967929031 3:194677114-194677136 TGATGTGGAGGACTGTCATAGGG + Intergenic
969089185 4:4680475-4680497 TGTTGTGAAAGGCTATCAGAGGG + Intergenic
969313753 4:6369560-6369582 TTTTGTGAATGACTGGCATTCGG + Intronic
975388008 4:73781260-73781282 TTTTGGGAAGGCCTGTCTTCTGG + Intergenic
976133793 4:81913178-81913200 TAATGTGTAGGGCTGTCGTAAGG - Intronic
976999065 4:91472766-91472788 TATTGTTAAGGCTTGTCATAAGG - Intronic
984350428 4:178584848-178584870 TTTTGAAAAGTGATGTCATATGG + Intergenic
984887507 4:184463663-184463685 TTTTTTGATGGGCTGTGGTACGG + Intronic
985032496 4:185803856-185803878 TTGGGAGAAGGGCTGTCTTAGGG - Intronic
986263501 5:6170762-6170784 TTTTGAGAAGGGTTGGCATTAGG - Intergenic
987151741 5:15047557-15047579 TTTTAAGAAGGGCTGTCAAATGG + Intergenic
991503989 5:67305497-67305519 TTTTGTGGAGAGGTGTAATAGGG + Intergenic
992527421 5:77626111-77626133 TTTTGGGAAAAGCTGTCATTGGG + Intergenic
994124773 5:96156433-96156455 TTTTATGCAAGGATGTCATAGGG - Intergenic
994299369 5:98128403-98128425 TTTTGCTAAGTGCTGGCATATGG + Intergenic
998296091 5:140969978-140970000 TTCTGTAGAGGGCTGTCAGAGGG + Intronic
999482297 5:151959847-151959869 ACTTCTGAAGGGCTGCCATAGGG + Intergenic
1002511602 5:179723071-179723093 TTTTGTGAAAGTCTGTGTTAAGG + Intronic
1004069259 6:12282877-12282899 TTTTATCAAGGGCAGTCAAAAGG - Intergenic
1006763722 6:36486413-36486435 ATATGTGAAAGGCTGTCACATGG - Intronic
1007151050 6:39691301-39691323 TTTTGAGAAAGGTTATCATAAGG - Intronic
1009409032 6:63344064-63344086 TTTTGGGCTGGGCTGTCATATGG - Intergenic
1009484680 6:64205779-64205801 ATTTGTGAAAGGCTTTCAAAGGG + Intronic
1010740737 6:79500791-79500813 TTGTTTAAAGGGCTGTCACATGG - Intronic
1012440275 6:99255734-99255756 TTTTGTGAATGGCTTTCTTTTGG - Intergenic
1013050672 6:106531815-106531837 TTCTGAGACGGGCTGCCATAGGG - Intronic
1013645650 6:112137493-112137515 TTTTGTGAAAGTCTGACAAAAGG - Intronic
1015148584 6:130015196-130015218 ATTTGTGAAGGGCTGGCTCATGG + Intronic
1017111354 6:150936097-150936119 ATATTTGAAGGACTGTCATATGG + Intronic
1021629965 7:22635170-22635192 TTTTTTGAAGGGCTCTCAATCGG - Intergenic
1022937699 7:35197069-35197091 TATTTTGAAGGACTGTCATGTGG + Intergenic
1025292561 7:57743639-57743661 TTTTGTGAAGGTTTTTCATCAGG - Intergenic
1025606225 7:63041771-63041793 ATATGTGAAAGGCTGTCATGTGG - Intergenic
1026043786 7:66890623-66890645 TTTTATGAAGAATTGTCATATGG + Intergenic
1028249745 7:88526534-88526556 TTCTGTGAAGGTCTCTGATATGG + Intergenic
1028253058 7:88558712-88558734 TTCTGTGAAGGTCTCTGATATGG - Intergenic
1029781173 7:102735355-102735377 ATTTGTTAAGGGCTGTTTTATGG + Intergenic
1030267980 7:107640199-107640221 TTTTGTGAATGGCTGGTATCTGG + Intergenic
1030773141 7:113499531-113499553 TTTAGTGAAGGCCTGTTATGTGG + Intergenic
1031362240 7:120860318-120860340 GTAGTTGAAGGGCTGTCATATGG - Intergenic
1033857493 7:145582458-145582480 TTTTGTGTAGGTTTGACATATGG - Intergenic
1035905428 8:3504499-3504521 TTTTATGAAGGGTTGCCATGAGG - Intronic
1038052394 8:23826203-23826225 TTGTGTCAAGAGCAGTCATAGGG + Intergenic
1038921336 8:32088144-32088166 GTTTGTGAAGGGCTATCATGAGG - Intronic
1039658897 8:39440514-39440536 TTTTGTGAAATGCTGTCAGGGGG + Intergenic
1039722361 8:40177941-40177963 TTTTGTCAAGGGCTGCCCTGAGG + Intergenic
1040899250 8:52401922-52401944 TTTTATAGAGGGCTTTCATAGGG + Intronic
1041611973 8:59861563-59861585 TTTTTTAAAGGTCAGTCATATGG - Intergenic
1042296135 8:67220384-67220406 TTCTTTGAAAGGCTCTCATAAGG + Intronic
1042361001 8:67883108-67883130 TTTTTTTAAGGGCTGTCTTTTGG - Intergenic
1044396466 8:91718969-91718991 TCTTGAGAAGGTCTCTCATATGG - Intergenic
1046097441 8:109578306-109578328 TTCTGGGAAGGGCTGTCTTCTGG - Intronic
1049136713 8:140908706-140908728 CCTTCTGAGGGGCTGTCATATGG - Intronic
1051217542 9:14814700-14814722 TTTTGTGAACGGCTGCAAGATGG - Intronic
1054163958 9:61702084-61702106 TTTTGTGAAGGTTTTTCATCAGG + Intergenic
1056039425 9:82646825-82646847 TTTTGTGAAAGATTCTCATAAGG + Intergenic
1058351982 9:104035837-104035859 TTTTTTGATAGGCTGTCATAGGG - Intergenic
1058836269 9:108860973-108860995 TTTTATGAAGGGCTGGGATCAGG + Intergenic
1060356007 9:122907632-122907654 TTTAGTGAAGGGTTTTCATCAGG + Intergenic
1061936684 9:133861719-133861741 TTTTGTCAGGGGCTGCCAGAGGG + Intronic
1186290578 X:8093376-8093398 TATTGTGTAGGGCTGTTTTAAGG - Intergenic
1186607574 X:11108238-11108260 TTTTGTCAAGTGCTATAATACGG + Intergenic
1187035011 X:15529203-15529225 TTTTGGGAAGGGATGTCAGCTGG - Intronic
1187788777 X:22924273-22924295 ATATGTGAAAGGCTGGCATATGG + Intergenic
1187888964 X:23915438-23915460 TTGTGAAAAGTGCTGTCATAGGG + Intronic
1190763775 X:53459176-53459198 TTTTGGGCACCGCTGTCATAGGG + Intergenic
1192074578 X:67979912-67979934 TTTTGTGATTGGGTGTCTTATGG - Intergenic
1194603629 X:95955179-95955201 TTTTGTGTTGGCCTGTCTTAAGG - Intergenic
1195754261 X:108185510-108185532 TTTTGTGAATCGGTGTAATAAGG - Intronic
1195772139 X:108362768-108362790 ATATTTGAAGGGCTGTCATGGGG - Intronic
1195967841 X:110445142-110445164 GTCTCTGAAGGGCTGTCATATGG - Exonic
1199497377 X:148468050-148468072 TTTTGTGCAGAGCTGCCATATGG + Intergenic