ID: 1093116438

View in Genome Browser
Species Human (GRCh38)
Location 12:15217486-15217508
Sequence TTGTCTACCAACACCCATCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 105}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093116438_1093116439 19 Left 1093116438 12:15217486-15217508 CCATGATGGGTGTTGGTAGACAA 0: 1
1: 0
2: 1
3: 8
4: 105
Right 1093116439 12:15217528-15217550 AAGCACTGAGTAAATCTTTTTGG 0: 1
1: 0
2: 0
3: 30
4: 349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093116438 Original CRISPR TTGTCTACCAACACCCATCA TGG (reversed) Exonic
904856125 1:33499496-33499518 GTGTCTACCATCACCCATCATGG + Intergenic
905970422 1:42137752-42137774 TTGGCTCCCAACACCCCTCCAGG - Intergenic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
908216355 1:61957659-61957681 TTCTTTACCAACACACATAATGG - Intronic
910100087 1:83566313-83566335 CTGTCTCCCAACAGCCTTCATGG + Intergenic
913119743 1:115728970-115728992 CTGTCTACCTACCACCATCATGG + Intronic
917664646 1:177213107-177213129 TAGTTTGCCAACACACATCATGG - Intronic
919658784 1:200222894-200222916 TTTTGTACCCACAACCATCATGG - Intergenic
919763767 1:201113915-201113937 TTGTCTACCCTCACCCTTCCTGG - Intergenic
920588036 1:207187616-207187638 ATATCTACCAACATCCATCTTGG - Intergenic
921228774 1:213047613-213047635 TTGTCTACTATAAGCCATCAAGG + Intergenic
924073926 1:240313173-240313195 TGCTCTAACAACACCCATCCAGG - Intronic
924498849 1:244616790-244616812 TTGTCTATCAACATCCTTCAAGG - Intronic
1064221439 10:13444193-13444215 TTGTACACCAGCACCCAACACGG + Intronic
1065969186 10:30792518-30792540 TTTCCTTCCAACACCCATCCTGG + Intergenic
1066002842 10:31120294-31120316 TTGTCCCCCAACCCCCACCATGG - Intergenic
1070277166 10:75018259-75018281 CAGTGTACCCACACCCATCAGGG + Intronic
1070964541 10:80521519-80521541 GTCTCTACCAAGATCCATCATGG - Exonic
1071899538 10:90105310-90105332 TTTTCTATCAATATCCATCAGGG - Intergenic
1074390181 10:113050511-113050533 TTTTCTACCTCCACCCATCAAGG - Intronic
1086156330 11:83670439-83670461 ATGTATACCAAAACCTATCATGG - Intronic
1092588135 12:9921135-9921157 TCTTCTACTAACACCCATGAAGG - Intronic
1093116438 12:15217486-15217508 TTGTCTACCAACACCCATCATGG - Exonic
1096916486 12:55038974-55038996 TTCTCTACCAAGACCCATGCAGG + Intergenic
1098974564 12:76889097-76889119 TTATTTACCAACTTCCATCAGGG + Intergenic
1103724547 12:122991209-122991231 TTGTCCCCAAACGCCCATCAGGG - Intronic
1106773742 13:32988112-32988134 TTTTCTACAAACACCCAAAAAGG - Intergenic
1111780504 13:92717814-92717836 TTGTCTTCCAACACACAGAATGG + Intronic
1111851512 13:93581933-93581955 TTATGTAAAAACACCCATCAGGG - Intronic
1118918532 14:70128809-70128831 TTTTATACCTACACCTATCATGG - Intronic
1120148353 14:81004243-81004265 TTGTGTACCAAAACCCTTAAAGG + Intronic
1121709763 14:96028900-96028922 TTGTCCATGCACACCCATCAGGG - Intergenic
1123106820 14:105845666-105845688 CTGTCTTCCAGCACCCACCAAGG - Intergenic
1123671464 15:22663807-22663829 TTGACTACCACTCCCCATCAAGG + Intergenic
1124323503 15:28737028-28737050 TTGACTACCACTCCCCATCAAGG + Intronic
1124527392 15:30470210-30470232 TTGACTACCACTCCCCATCAAGG + Intergenic
1124771261 15:32537473-32537495 TTGACTACCACTCCCCATCAAGG - Intergenic
1126501629 15:49352464-49352486 TTGGCTACCAATACCCTACAAGG - Intronic
1127025804 15:54804891-54804913 TTCTCTACCACCACCCTTGATGG + Intergenic
1128003223 15:64213895-64213917 ATGTCTATCAACACGCATCTTGG - Exonic
1128562717 15:68679113-68679135 CTGTATCCCAACACCCAGCACGG - Intronic
1132745448 16:1434351-1434373 CTGTCTCCCAGCACACATCAGGG + Intergenic
1133647126 16:7774993-7775015 TTTTCTACCCACACGGATCATGG + Intergenic
1134887065 16:17802935-17802957 TTGTCTTCCAGCAGCCCTCAGGG + Intergenic
1137314210 16:47299534-47299556 CTGTCCTCCAACCCCCATCAGGG - Intronic
1137959286 16:52865463-52865485 TTGTCTTCCAACATCCAGTATGG + Intergenic
1140995720 16:80257777-80257799 TTGTCTAGTAATACCCAACAAGG + Intergenic
1141639928 16:85335196-85335218 TTCTCTCCCTACACCCATCCCGG + Intergenic
1141740203 16:85886476-85886498 AAGTCTACCAACACCTAGCAAGG - Intergenic
1143779367 17:9221324-9221346 TTCACGACCAACACCCATCGGGG - Intronic
1146873991 17:36393214-36393236 TTGCATACCTACACCCATCCAGG + Intronic
1147065396 17:37919659-37919681 TTGCATACCTACACCCATCCAGG - Intergenic
1149998303 17:61416487-61416509 TTGACTACCAACACGAAACAAGG - Intergenic
1150284688 17:63948204-63948226 TGGACTCCCACCACCCATCATGG + Intronic
1151790182 17:76300565-76300587 CTGTCTGCCAAAACCCATAATGG - Intronic
1155004756 18:21718744-21718766 TTGTCTACTAACACCAAGGAAGG - Intronic
1155567111 18:27147478-27147500 TGGGCTACCAACACTCATCTGGG - Intronic
1158326678 18:56320496-56320518 TCTTCTACCAACACCCATCCAGG + Intergenic
1158337134 18:56425263-56425285 TTGACACCCAACACCCAACATGG + Intergenic
1159353025 18:67299620-67299642 CTGTATACCATAACCCATCAGGG - Intergenic
1159609121 18:70507142-70507164 TTGGCTACCTACAGCCACCATGG - Intergenic
1159797358 18:72861203-72861225 TTGCCTACCAAAAGCCATAATGG - Intronic
1163932120 19:20405755-20405777 TTTTCCACCAACAACCAACATGG - Intergenic
1164021107 19:21306602-21306624 TTTTCTACCAACAATCAACAGGG - Intronic
1167227408 19:48255964-48255986 TTGACTGCCCACAGCCATCATGG - Intronic
1168319449 19:55500421-55500443 TTCTCTCCCCACACCCCTCACGG - Intronic
929799759 2:45089593-45089615 TTGTCTAAGATCACCCAACAAGG - Intergenic
930431541 2:51283008-51283030 CTGTCTACCAAGTCCTATCAAGG + Intergenic
941658897 2:168174177-168174199 TTCTCTACAAACACCAATTAAGG - Intronic
945318560 2:208395671-208395693 TTCTCTGCCAACACCCAGAATGG + Intronic
947268621 2:228308358-228308380 TTCTCTACCAACACCCAGAATGG + Intergenic
1174388576 20:50202289-50202311 CTGTCTACCAAGACCCATTCAGG + Intergenic
1175998552 20:62821925-62821947 GCTTCTACCAACACCCACCAAGG - Intronic
1180026819 21:45169242-45169264 TTGTCTGACACCACCCAACAAGG + Intronic
949543125 3:5049765-5049787 TTGTCTCCCCACACTCACCAGGG - Intergenic
953542736 3:43836539-43836561 TTGTCCCCCAAAACCCAGCAAGG - Intergenic
956014716 3:64869633-64869655 TTGTGTTCCAAAACCCATGAAGG - Intergenic
956584599 3:70851145-70851167 TTGTTTACAAACACACACCAAGG - Intergenic
962813941 3:138981863-138981885 TTCTCCACCAACACCTATCTGGG + Intergenic
964044769 3:152309849-152309871 TAGTCTATCAACACCCAAAAAGG - Intronic
968277852 3:197454653-197454675 TTGTCTATCATCACCCAGGAGGG + Intergenic
968800265 4:2738693-2738715 TTGTCTTCCAAGTCCCATCCAGG - Intergenic
971294203 4:25374922-25374944 CTGCCTACCAACACACATGAGGG + Intergenic
977534357 4:98239892-98239914 TTGTTTACCAAAACACATGATGG - Intergenic
977668537 4:99669391-99669413 TCTTCTACCAACAGCCAACAAGG - Intergenic
978138299 4:105289669-105289691 TTGTCCACCCATGCCCATCATGG - Intergenic
979792296 4:124800399-124800421 TTGTCTACCATTATCCTTCAGGG - Intergenic
980743601 4:136985447-136985469 TTATCTTCCAACACCCATATGGG - Intergenic
982567452 4:157003706-157003728 ATGTCTACCATAACCCTTCATGG - Intergenic
985140390 4:186833514-186833536 TTGTCTGCCAAGAACCTTCAGGG - Intergenic
985262443 4:188127701-188127723 CTGTCTACCCACACTCATCTGGG + Intergenic
989419209 5:41216402-41216424 TTCTCTTCCTACACCCATCTAGG + Intronic
999020016 5:148154676-148154698 TTGGCTATCACCACCCATCAGGG + Intergenic
1001869624 5:175139927-175139949 TTCTCTCCCAGCACCTATCACGG - Intergenic
1002675680 5:180910647-180910669 TTCTCTACCTACAACCATCTTGG + Intronic
1002923455 6:1590340-1590362 TTGTCTTTCTACATCCATCAAGG - Intergenic
1003098620 6:3160312-3160334 TTATATACTAACACACATCACGG - Intergenic
1008996841 6:57669048-57669070 TTGCTTACCAACACACAACATGG + Intergenic
1009185356 6:60568382-60568404 TTGCTTACCAACACACAACATGG + Intergenic
1012022691 6:93945136-93945158 TTGTATACCAAGAACCATGAGGG - Intergenic
1012930742 6:105313580-105313602 TTGTCTACCATCACCTATTAGGG + Intronic
1017232942 6:152092167-152092189 TTCTCTACCAACAGCCCACATGG + Intronic
1029700503 7:102243725-102243747 TTGTCTAAGATCACCCAGCAGGG + Intronic
1030465464 7:109896701-109896723 GTGTCTACCAACACACATCCTGG + Intergenic
1032294869 7:130627575-130627597 TTCTTTACCTACACCCATCTTGG + Intronic
1032627662 7:133609827-133609849 TTGTGTAACTACACCCATCGTGG - Intronic
1034411197 7:150943057-150943079 GTGTCCACCAACACCCAGCCCGG + Intergenic
1043914584 8:85906729-85906751 TTTCTTACCAACAACCATCAGGG + Intergenic
1046356320 8:113089916-113089938 TAGTCAACCAACAGTCATCATGG - Intronic
1051219247 9:14831205-14831227 TTCTCTGCCAACACCCAGAATGG - Intronic
1056201695 9:84283161-84283183 TTCTCTTCTAAAACCCATCATGG - Intronic
1059958044 9:119538541-119538563 TGGTCTACCTATACCCATTAAGG + Intergenic
1191204760 X:57822120-57822142 TTCTCTACCAACACCCAGAGTGG + Intergenic
1194429436 X:93782723-93782745 TTCTCTACCAACACCGATATTGG + Intergenic
1196164088 X:112519307-112519329 TTGTGTACCATCACACATGATGG - Intergenic