ID: 1093117333

View in Genome Browser
Species Human (GRCh38)
Location 12:15226937-15226959
Sequence TCAGATCCACCCTTAGTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093117333_1093117338 21 Left 1093117333 12:15226937-15226959 CCTGGGACTAAGGGTGGATCTGA 0: 1
1: 0
2: 0
3: 9
4: 133
Right 1093117338 12:15226981-15227003 GACTAAAATGAGACCTTTACAGG 0: 1
1: 0
2: 0
3: 11
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093117333 Original CRISPR TCAGATCCACCCTTAGTCCC AGG (reversed) Intronic
900291610 1:1926109-1926131 GCAGACCCAGGCTTAGTCCCAGG + Intronic
900769440 1:4528931-4528953 CCAAATCAACCCCTAGTCCCAGG + Intergenic
900802539 1:4746301-4746323 TAGGGTCCACCCTGAGTCCCAGG + Intronic
901651799 1:10747214-10747236 CCAGCCCCACCCTTAGTCTCAGG - Intronic
905028660 1:34867263-34867285 TCCTATCCACCCTTACTGCCAGG + Intronic
907689533 1:56648221-56648243 TCATTTCTACCCTCAGTCCCAGG + Intronic
911925742 1:103830323-103830345 TCAGATTCTCCTTTTGTCCCAGG + Intergenic
912250570 1:108008238-108008260 TCAGATCCACAGATAGTGCCAGG + Intergenic
914341437 1:146763705-146763727 TCAAATTCACCCTTAGGCACAGG - Intergenic
921049554 1:211501297-211501319 CCAGCTCCACCCTTGGTGCCAGG - Intergenic
921677343 1:217990900-217990922 TCAGTTCTGCCCTTAGACCCAGG - Intergenic
922708356 1:227805810-227805832 TCTGATTCACCCTTACTCCTAGG + Intergenic
923917937 1:238530049-238530071 TCAGAGTCTGCCTTAGTCCCGGG + Intergenic
1063348135 10:5330125-5330147 TCAGATCAACCCTGGGTCCTGGG - Intergenic
1067203411 10:44194207-44194229 TCAGATCCTCCCTTGGAACCTGG + Intergenic
1068820768 10:61375902-61375924 ACAGATCCACCCTTAATCTGAGG + Intergenic
1072198672 10:93139271-93139293 ACAGATCCACTCTGAGACCCTGG - Intergenic
1080316381 11:30954802-30954824 TCAGATCCATCCATAGTACTTGG + Intronic
1084149992 11:67283657-67283679 TCAGCCCCACCCTGAGTCCCGGG - Intronic
1084958144 11:72702335-72702357 TGAGCTCCACCCTCAGTCCTGGG + Intronic
1085234487 11:75003171-75003193 TCAGTTCCATCCTTATTCCTTGG + Intronic
1087166909 11:95014159-95014181 TCAGTTCTATCCTAAGTCCCAGG + Intergenic
1091615949 12:2051930-2051952 CCACATCCACCCTCATTCCCTGG - Intronic
1093117333 12:15226937-15226959 TCAGATCCACCCTTAGTCCCAGG - Intronic
1096416789 12:51421527-51421549 TCAGATCCACCAGTCCTCCCAGG + Intronic
1096499645 12:52056944-52056966 TCAGATCCACTCCCACTCCCGGG + Intronic
1100911241 12:99365632-99365654 CCAGAACCACCCTTAGGCCCAGG - Intronic
1102576119 12:113857242-113857264 TCAGAGCCACCCTTGGTCTATGG - Intronic
1103075596 12:117979950-117979972 TTAGAAACCCCCTTAGTCCCAGG - Intergenic
1106333876 13:28765101-28765123 TCAGATCCAGACTTAGGCCAGGG + Intergenic
1108571694 13:51758042-51758064 TCAGATCTGCCTTTATTCCCTGG - Intronic
1109785277 13:67166157-67166179 TCAGATCCACTATAACTCCCTGG + Intronic
1115505835 14:34093285-34093307 TCAGATCCACCCTTGGGCTGGGG + Intronic
1119258133 14:73217601-73217623 ACAGATCCTTCCTTAGTCCCTGG + Intronic
1119543531 14:75456018-75456040 TCAGCTCCTCCATTAGCCCCTGG + Intronic
1119821829 14:77623007-77623029 TCAGATCTACCCTTAGTTTTTGG - Intergenic
1120145525 14:80974539-80974561 TCACAACCACCCTCAATCCCTGG + Intronic
1120911745 14:89672959-89672981 TCAGATCCCCTCTTACGCCCTGG + Intergenic
1122786708 14:104167332-104167354 TCAAACCCAACCTTAGTCCCTGG - Intronic
1122924678 14:104894153-104894175 TCAGTTTCCCCCTTAGGCCCAGG + Intronic
1126508153 15:49432506-49432528 TCACCTCCATTCTTAGTCCCTGG + Intronic
1126725308 15:51625386-51625408 TCAGTTCCACCTTCAGCCCCAGG - Intergenic
1127735321 15:61834037-61834059 TCAAATCCACCCATAGGGCCAGG - Intergenic
1133128806 16:3663723-3663745 TCAGAGCCTTCCTTAGACCCAGG - Exonic
1139992845 16:70953737-70953759 TCAAATTCACCCTTAGGCACAGG + Intronic
1144704249 17:17356850-17356872 TCAGACCCAGCCCTGGTCCCAGG + Intergenic
1145878358 17:28336276-28336298 ACGGATCCGCCCTTAGCCCCGGG + Intronic
1146603017 17:34234891-34234913 CCATTCCCACCCTTAGTCCCTGG + Intergenic
1147768262 17:42851185-42851207 TCCTTCCCACCCTTAGTCCCAGG + Exonic
1149504586 17:57183684-57183706 TCAGTTTCACCCTTATTCCTAGG + Intergenic
1150729121 17:67676536-67676558 TCAGATCTAACCTAAGTCACCGG - Intronic
1150985172 17:70188006-70188028 TCAGTCCCACCCTTGGCCCCAGG + Intergenic
1158427236 18:57351734-57351756 TCAGATCCATCCTTCGGGCCTGG - Exonic
1160191434 18:76717324-76717346 ACAGATCCACCCTCAATCCGGGG - Intergenic
1160818116 19:1045511-1045533 TTAGCTCCACCCTTATTCCAGGG - Intronic
1161146831 19:2683922-2683944 TCAAATCCGCCCTCAGCCCCAGG + Intronic
1168239085 19:55080372-55080394 TCTGATCCCGCCTTAGCCCCAGG - Intronic
925837485 2:7960114-7960136 ACAGATCCACCTTGAGCCCCAGG - Intergenic
928983614 2:37159231-37159253 TCAAATCCACCCAAATTCCCAGG - Intergenic
930185794 2:48410985-48411007 CCAGAGCCACCATTAGTTCCTGG - Intergenic
931248342 2:60509381-60509403 TCAGGTCCACGGTTAGCCCCTGG - Intronic
931340046 2:61392197-61392219 TGACATGCACCTTTAGTCCCAGG + Intronic
935261725 2:101361750-101361772 GCAGCCCCACCCTTAGTCACAGG + Intronic
938691868 2:133799506-133799528 TCTGATGCCCCCTCAGTCCCTGG + Intergenic
940173788 2:150856522-150856544 TTAGATCCATCTATAGTCCCAGG + Intergenic
941079702 2:161046262-161046284 TCAGCTTGGCCCTTAGTCCCTGG + Intergenic
942994953 2:182249523-182249545 TCAGTACCACCTTTAGCCCCAGG - Intronic
943509342 2:188804495-188804517 GCAGATCCACCCTTAATCTAGGG + Intergenic
945245398 2:207712229-207712251 GCAGAACCAGCCTTCGTCCCGGG - Intronic
947909876 2:233793910-233793932 TCGGGTCCACACTTACTCCCAGG + Intronic
948463663 2:238142192-238142214 TCTGAGCCACTCTTTGTCCCCGG - Intronic
1169422466 20:5471398-5471420 GCAGAAGCACCCTTTGTCCCTGG - Intergenic
1170974133 20:21145612-21145634 TCAGTTCCTCTTTTAGTCCCAGG - Exonic
1172743230 20:37185758-37185780 TGGGATGCACCCATAGTCCCAGG - Intronic
1172941088 20:38655241-38655263 TCATTTCCACCCTTTGTCCAAGG - Intergenic
1173643498 20:44619409-44619431 TCACAGCCACCCTTAGGCTCAGG + Intronic
1178508887 21:33185581-33185603 TCAGAGCAACCCTGGGTCCCTGG - Intergenic
1181559844 22:23693692-23693714 TCAGAGTCACCCACAGTCCCAGG - Intronic
1183971672 22:41482161-41482183 GCAGAGCCTCCCTTACTCCCTGG + Intronic
953133388 3:40162013-40162035 TCAGATACACCTTTTCTCCCAGG + Intronic
953836506 3:46350712-46350734 CCAGATCCACTCTGAGTCCCAGG + Intergenic
954129784 3:48554546-48554568 TCAGTTCCACACTTAGAGCCTGG + Intronic
954290230 3:49645854-49645876 GCAGACCCACCCTTAGGACCTGG - Intronic
955067316 3:55544419-55544441 TCACATCCACCCTTTGTCTCTGG + Intronic
955887622 3:63617747-63617769 TCAAATCCAGCCATCGTCCCAGG - Intergenic
957243754 3:77691942-77691964 CCAGATCCACCAGTATTCCCTGG - Intergenic
958044830 3:88271008-88271030 TCAGCTCTACCCACAGTCCCAGG + Intergenic
960595194 3:119401965-119401987 TCAAAGCCACCCTCAGCCCCGGG - Exonic
961056044 3:123789579-123789601 TCATTTCCACCTTTAGACCCAGG - Intronic
961118031 3:124348516-124348538 TCCAATCCACCCATATTCCCTGG - Intronic
962840947 3:139231907-139231929 TCAGATTGACCCTCAGTCACAGG - Intronic
962979946 3:140479286-140479308 TTAGATTTACCCTTAGTCCTGGG - Intronic
965009054 3:163062843-163062865 TCAGATTCACTTTGAGTCCCAGG + Intergenic
966735602 3:183184406-183184428 GCAGATACACCCTGAGTCTCTGG + Intronic
967411257 3:189168755-189168777 CCAGATACACCCCTTGTCCCAGG - Intronic
968854118 4:3106007-3106029 TCAGCTCCATCCTGAGTCACTGG + Intronic
974575806 4:63719953-63719975 TCAGGTTCATCCTTTGTCCCTGG - Intergenic
976053793 4:81039170-81039192 ACACATCCACCCTCAGTCACTGG - Intronic
979477202 4:121172104-121172126 TCAGCTCCAGCCTTACTCACTGG + Intronic
984957434 4:185059364-185059386 TCCGCTCCTCCCTCAGTCCCTGG + Intergenic
987594676 5:19981821-19981843 TCATATCCACACTTCCTCCCAGG + Intronic
991525750 5:67556029-67556051 GCAGATCCACCCTTAATCTGGGG - Intergenic
992140681 5:73793887-73793909 TCAGCTCCAACCTCAGCCCCGGG - Intronic
995603534 5:113825509-113825531 TCAGAACCACACCTAGTGCCTGG - Intergenic
996125623 5:119722554-119722576 TCACATCCACCCATCTTCCCTGG + Intergenic
996607826 5:125344650-125344672 TCAGAGCCACTCATAGTCACTGG + Intergenic
1005854758 6:29852581-29852603 TCAGATTCACCCTTTCTCCGAGG + Intergenic
1007476311 6:42122186-42122208 TGAGAACCACCCTTAGACCCAGG + Intronic
1012416725 6:99020827-99020849 GCAGATCCACCCTTAATCTGTGG - Intergenic
1013132287 6:107244627-107244649 TCTGAACCACCCAGAGTCCCTGG + Intronic
1014039397 6:116807486-116807508 TAATATCCACCCTTGGCCCCTGG - Intronic
1015792655 6:136979686-136979708 TCAGATGCACACTTTGTCCTTGG + Intergenic
1017964281 6:159250649-159250671 TCATATCCTGCCTTACTCCCAGG + Intronic
1018060221 6:160084353-160084375 TCAGAACCACCCTCTGTGCCAGG - Intronic
1019428018 7:986508-986530 GCACATCCACCCAGAGTCCCTGG + Intronic
1019539594 7:1545734-1545756 CCAGAAGCCCCCTTAGTCCCTGG + Exonic
1019720610 7:2568367-2568389 TCAGAAACACTCTTGGTCCCAGG + Intronic
1022478481 7:30727514-30727536 TCAAAATCACCCTTAGTCCCAGG - Intronic
1022802991 7:33793342-33793364 CCAGATCAGCCCTTAATCCCTGG + Intergenic
1023021980 7:36019035-36019057 TAAGAACCACCCTCAGTCCTGGG + Intergenic
1023617546 7:42035332-42035354 CCAGATGCACCCTTACTCCAGGG + Intronic
1024490913 7:49985052-49985074 ACACATCCACACTTACTCCCAGG - Intronic
1029342339 7:99955391-99955413 TCAGATCCCCTCCAAGTCCCAGG + Intergenic
1029620990 7:101689538-101689560 TCAGAGCCTCCCATGGTCCCGGG + Intergenic
1031380441 7:121079116-121079138 TCACATACACCCATATTCCCAGG + Intronic
1033548047 7:142420542-142420564 TCAAATCCACCCTTAGCCAGTGG - Intergenic
1034032523 7:147783973-147783995 ACAGATCCTCTCTTAGTCTCAGG - Intronic
1039888760 8:41670693-41670715 TCAGTCCCACCCTGAGGCCCAGG - Intronic
1040330278 8:46382332-46382354 TCAACTTCTCCCTTAGTCCCTGG - Intergenic
1040766966 8:50923614-50923636 TCAGATTCCCTCTTACTCCCGGG + Intergenic
1042014737 8:64296037-64296059 TCAGCTCCTCCCCTAGTCACAGG + Intergenic
1042188112 8:66157011-66157033 TCAGATCCACAATTAGGTCCTGG - Intronic
1042901003 8:73727373-73727395 TCTCATTCACCCTTAATCCCAGG + Intronic
1046851063 8:118973354-118973376 TCAGATAAAACCTTAGCCCCAGG - Intergenic
1048891301 8:138950586-138950608 TCCACTCCACCCTTAGTCTCTGG + Intergenic
1049485704 8:142858885-142858907 GCAGCTCCTCCCTTAGTCCAGGG - Intronic
1049567292 8:143347785-143347807 GCAGAGCCACCCTCAGTCCAAGG + Intronic
1050693899 9:8258778-8258800 TCAGTTCCTACCTTAGCCCCAGG - Intergenic
1053073313 9:35113838-35113860 CCAGAGCCAACATTAGTCCCTGG + Intronic
1054783370 9:69186878-69186900 TCAGTTTCCTCCTTAGTCCCTGG + Intronic
1059698153 9:116748363-116748385 CCAGCTCCAGCCTTAATCCCAGG + Intronic
1060201484 9:121654135-121654157 TCAGCTGCAGCCTTAGTCCCAGG - Intronic
1189949514 X:46214330-46214352 TCAGTTCCACCCCTAATCTCTGG + Intergenic