ID: 1093119713

View in Genome Browser
Species Human (GRCh38)
Location 12:15254139-15254161
Sequence CTCTGCTTCTAGCAGTGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 226}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093119713 Original CRISPR CTCTGCTTCTAGCAGTGCCC TGG Intronic
900269624 1:1780474-1780496 CTCTCCTGCAGGCAGTGCCCAGG - Intergenic
900690751 1:3978865-3978887 CACTGCCTCCAGCAGGGCCCTGG - Intergenic
900895810 1:5482181-5482203 CTCAGCATCAAGCAGTGTCCAGG - Intergenic
903236281 1:21952739-21952761 CACTGCTTCTGGCTGGGCCCAGG - Intergenic
903312979 1:22474864-22474886 TTCTGGTTCCAGCAGAGCCCAGG + Intronic
904484916 1:30818278-30818300 CTCACATTCTAGCTGTGCCCAGG - Intergenic
905268526 1:36771462-36771484 CTCTGCTTTTAGCAGTCAGCAGG - Intergenic
906561883 1:46764343-46764365 CTCTCCTTCCAGCTCTGCCCAGG + Intronic
907398950 1:54212613-54212635 GTTTGCTTTTGGCAGTGCCCTGG + Exonic
907566721 1:55442352-55442374 CTGAGCTTCTAGCAGGCCCCAGG - Intergenic
908664537 1:66475481-66475503 CCCTGCCTCTAACAGTGACCAGG - Intergenic
908793020 1:67802038-67802060 CTCTCCCTCTGGCACTGCCCAGG - Intronic
912393392 1:109320518-109320540 CTCTGCTTGCAGCAGTCCACTGG + Intronic
912795838 1:112693043-112693065 CCCTGCTTCTTGCGGAGCCCTGG - Intronic
920213074 1:204342737-204342759 CTCTGCTTCTCCAAGTTCCCAGG - Intronic
921410929 1:214835797-214835819 CACTGCTGCTCGCAGAGCCCAGG - Intergenic
921891556 1:220358888-220358910 ATCTCTTTCTAGCAGTGCCATGG + Intergenic
1063197517 10:3757530-3757552 CTTTGCTCCTAGGACTGCCCGGG - Intergenic
1064038917 10:11940776-11940798 CCCTGCTTTTAGCCTTGCCCTGG + Intronic
1064101204 10:12465896-12465918 ATCTGCTTCTAGCAGTGGGCAGG - Intronic
1065325758 10:24549553-24549575 CTGTGCTTCTATCAGGGTCCAGG - Intergenic
1068733482 10:60386096-60386118 CCCTGCTCCCAGCAGGGCCCTGG - Intronic
1069120893 10:64567757-64567779 CTCTGCTTTTTGCACTTCCCAGG + Intergenic
1070304631 10:75233057-75233079 CTCTGCTTCCATCAGTCTCCAGG + Intergenic
1071404848 10:85319983-85320005 CTCTGCAGCTGGCAGAGCCCTGG - Intergenic
1071741935 10:88369296-88369318 CTCTGCTTTGATCTGTGCCCAGG + Intronic
1072828081 10:98628710-98628732 CTCTGCCTCTAGCAGGCCCAAGG - Intronic
1075953321 10:126500903-126500925 CTCTGTTTGTAGAATTGCCCAGG + Intronic
1076195547 10:128514936-128514958 CTCTTCCTCAAGCACTGCCCAGG - Intergenic
1076299201 10:129411959-129411981 CACTGCATCTAGGAGTGCCAGGG + Intergenic
1076572399 10:131441252-131441274 ATCCTCTTCTGGCAGTGCCCAGG - Intergenic
1079380276 11:19931980-19932002 CCCTGCTTCAGTCAGTGCCCCGG - Intronic
1080210918 11:29783978-29784000 CTATGCTTAGAGCAGTGCCTGGG - Intergenic
1080285479 11:30606449-30606471 TGCTGCTTTCAGCAGTGCCCTGG - Intergenic
1080459911 11:32445359-32445381 CCCTTCTTCTAACAGTACCCTGG - Intergenic
1081566806 11:44265373-44265395 CTCTGCTGCTAGCCTGGCCCTGG - Intronic
1083763193 11:64829806-64829828 CTCTGCTACCAGCTGGGCCCGGG - Exonic
1084155045 11:67308571-67308593 CTCTGCTTCTAACTCTGTCCTGG + Intronic
1084789352 11:71463592-71463614 GGCTGCTTCTGGAAGTGCCCGGG + Intronic
1085038665 11:73314290-73314312 CTTTGCTTCTGGCAGTCCCTGGG + Intronic
1086440367 11:86823512-86823534 CTCTGCTTCTAGCCAGGTCCTGG - Intronic
1086859231 11:91905636-91905658 CTCTGCTTGTAGCAATGCCGTGG + Intergenic
1088561699 11:111121902-111121924 CTCTGCTTTTCCCTGTGCCCAGG - Intergenic
1088979394 11:114848242-114848264 CTTTGTTTCTAGCGGTGCTCCGG - Intergenic
1090816121 11:130297656-130297678 CTTTGCTTCTGGTAGTGCCTTGG - Intronic
1093119713 12:15254139-15254161 CTCTGCTTCTAGCAGTGCCCTGG + Intronic
1094464951 12:30743131-30743153 CCCCGCTTCTACCTGTGCCCTGG + Intronic
1095286164 12:40413214-40413236 CTCTGCTTCAAGCAGTGTGCAGG + Intronic
1095721567 12:45406996-45407018 CCCTGCTTCTAGCCTTGGCCAGG + Intronic
1095726916 12:45463911-45463933 CTCTGCTTCTCACTGTGGCCCGG - Intergenic
1096105881 12:48997031-48997053 CACGGCTTCTCGCAGGGCCCCGG + Exonic
1097367111 12:58728972-58728994 CTATGTTTCTAGCACTGCTCTGG + Intronic
1098172058 12:67757095-67757117 CTTTGGTTCTAGCAATGCCACGG + Intergenic
1100813479 12:98362994-98363016 TTCTGCTGCTAGCAGTGGACTGG - Intergenic
1102251354 12:111389681-111389703 CTCAGCACCTGGCAGTGCCCAGG + Intergenic
1102863542 12:116356758-116356780 CTCTGCTTCTAGGAGAACCATGG - Intergenic
1103576862 12:121884253-121884275 CTCTGCCTCAAGCAATTCCCCGG + Intergenic
1103724611 12:122991455-122991477 GTCTGCTTCTGGCAGAGCCCTGG + Intronic
1103944644 12:124519260-124519282 CTCTGCTTCTCCAAGTGCTCTGG + Intronic
1106054791 13:26228148-26228170 CTCAGTTTCTACCAGGGCCCAGG + Intergenic
1106202274 13:27549410-27549432 CTTTTCTTCTCCCAGTGCCCGGG + Intronic
1108132492 13:47317885-47317907 CTATGCTATTAGCAGTTCCCAGG + Intergenic
1109215271 13:59582810-59582832 TTCTGCTTCTAGGAGGGCCAAGG - Intergenic
1112913156 13:104514685-104514707 CTCAGCTTCCAGCAGTTCCTGGG + Intergenic
1113114397 13:106859671-106859693 CTCTGCTTCTAGGCCTGCTCAGG + Intergenic
1113309347 13:109115467-109115489 CTCTGCATCTAGCAGTGCACAGG + Intronic
1114425903 14:22622349-22622371 TTCTTGTTCTAGCAGTGCCTGGG - Intergenic
1117828755 14:59729639-59729661 TGCTGCTACTAGCAGTGCTCTGG - Intronic
1117837164 14:59819442-59819464 CTCTGTGTCTAGCTGTGGCCGGG - Intronic
1118671471 14:68132662-68132684 CTCTGGTTCTAGCAGTTTCTGGG - Intronic
1119770668 14:77218970-77218992 GTCTGCCTCCTGCAGTGCCCAGG - Intronic
1121017451 14:90557133-90557155 CTCTGCTTCTACCTGTCCTCAGG + Intronic
1121115838 14:91341956-91341978 CTCTGCTTCTGTCAGTGACATGG - Intronic
1122771141 14:104098515-104098537 CCCTGCTTCTTACAGAGCCCTGG - Intronic
1123065115 14:105614996-105615018 CTCTGCTTCAAGGAGTGCCCTGG + Intergenic
1123069316 14:105634430-105634452 CTCTGCTTCAAGGAGTGCCCTGG + Intergenic
1123088417 14:105730219-105730241 CTCTGCTTCAAGGAGTGCCGTGG + Intergenic
1123094360 14:105759590-105759612 CTCTGCTTCAAGGAGTGCCCTGG + Intergenic
1124617717 15:31254517-31254539 GTCTGCTTCCAGCATTACCCAGG - Intergenic
1130128064 15:81110898-81110920 TTCAGCTTCTAGCAGACCCCTGG - Intronic
1130911724 15:88275520-88275542 GTCAGCTTCTGCCAGTGCCCAGG - Intergenic
1131528294 15:93170438-93170460 TTCAGCATCCAGCAGTGCCCTGG + Intergenic
1135632886 16:24049641-24049663 CTCAGCTTCTAGATGTTCCCTGG - Intronic
1135953429 16:26936250-26936272 CTCTGCTTTTAAGTGTGCCCTGG - Intergenic
1136341390 16:29646059-29646081 CTCTGCTTCTCTCATTGCTCAGG - Intergenic
1136381392 16:29897659-29897681 CTCTGGTTCTGTCTGTGCCCAGG + Intronic
1136569052 16:31086093-31086115 CTTTGCATCAAGCTGTGCCCAGG - Exonic
1136655314 16:31705929-31705951 CTGTGCATCTTGCAGTTCCCAGG - Intergenic
1137542990 16:49377559-49377581 CTCTGCTTCCAGATGCGCCCTGG - Intronic
1138432932 16:56981106-56981128 CTCTGCTTCGGGAAGAGCCCTGG + Intronic
1140132818 16:72178986-72179008 CTCTGCTTCTTGAGTTGCCCTGG + Intergenic
1140309152 16:73832268-73832290 CTCAGCATATAGCAGAGCCCTGG - Intergenic
1140925730 16:79581459-79581481 CTCTGCTGCTGGCAGCACCCAGG + Intergenic
1141848595 16:86628553-86628575 CTCTGCTTTCAGAAATGCCCTGG + Intergenic
1142689007 17:1593541-1593563 CTCTGCTCCTGGCAGAGCCCAGG + Intronic
1143433973 17:6909023-6909045 CTCTGCTACCAACAGTGCCCTGG - Intronic
1143572540 17:7769037-7769059 CTCTGCTTCTTGCACTGTCTCGG + Intronic
1145110926 17:20160458-20160480 CTCTGCTTGATGCAGTCCCCTGG - Intronic
1145270961 17:21404716-21404738 CTCTGCTTCTCCCAGGGGCCTGG + Intronic
1145309166 17:21692103-21692125 CTCTGCTTCTCCCAGGGGCCTGG + Intergenic
1151444791 17:74156183-74156205 CTCTGCTTCAAGCAGAGTCCAGG + Intergenic
1151692233 17:75693770-75693792 CTCTGCTTCCCCTAGTGCCCTGG + Intronic
1152076706 17:78164465-78164487 CTCTGCTCTCAGCAGTGGCCGGG - Intronic
1152094603 17:78265904-78265926 CTCTGCTCCTGCCAGGGCCCTGG - Intergenic
1152505205 17:80744956-80744978 CCTGGCTTCTAGCAGAGCCCTGG + Intronic
1152921738 17:83069298-83069320 CTGTGCTCCTAGGGGTGCCCGGG + Intergenic
1153820037 18:8825021-8825043 GGCTGCTTCTGGCAGTGCTCTGG - Exonic
1157811308 18:50698217-50698239 CTCTGGTTCTAGAAGCCCCCTGG - Intronic
1158960623 18:62584917-62584939 CAGTGCTTCTGGCAGAGCCCAGG + Intronic
1159949594 18:74473153-74473175 CTCTGAATGTTGCAGTGCCCAGG + Intergenic
1160677405 19:398807-398829 CTCAGCACCCAGCAGTGCCCAGG - Intergenic
1160800213 19:964191-964213 CTCGGCTCCCTGCAGTGCCCAGG + Intronic
1161030272 19:2054864-2054886 CTCAGCTCCCTGCAGTGCCCAGG - Intergenic
1161120199 19:2521480-2521502 CTCAGCTCCCTGCAGTGCCCCGG + Intronic
1161141996 19:2653631-2653653 CTCAGCTCCCCGCAGTGCCCAGG - Intronic
1161719318 19:5894431-5894453 CTCTGCTTCCCCCAGTTCCCAGG - Intronic
1161725650 19:5927004-5927026 CTCCGCCCCTTGCAGTGCCCAGG - Intronic
1162431503 19:10631611-10631633 CTCTGCTCCATGCAGTGGCCCGG + Exonic
1166334735 19:42098915-42098937 CTCTGCTCCTGCCAGTGGCCAGG + Intronic
1166743249 19:45126794-45126816 CTGTGCATGTAGCAGTGACCAGG + Intronic
925361875 2:3285422-3285444 CTCTGCTTCTATCAAGGCTCAGG + Intronic
926350771 2:11992178-11992200 CTCTGCTTCCAGGAATGACCAGG + Intergenic
927706870 2:25301808-25301830 CTGTGCTGCCAGCACTGCCCTGG - Intronic
927757506 2:25720901-25720923 CACAGCTTGGAGCAGTGCCCTGG + Intergenic
927855319 2:26524025-26524047 CTCTGCAGCCAGCAGTGCCCTGG + Intronic
928111210 2:28510353-28510375 CTCTGCTTGGACCAGTGCCCTGG + Intronic
929331453 2:40686382-40686404 CTCACCTTCTAAGAGTGCCCTGG + Intergenic
929464346 2:42131160-42131182 CTCAGCTTCTATCAGTTCTCTGG - Intergenic
933833975 2:86231313-86231335 CCCTGCTTCCAGCAGTGACAGGG + Intronic
933978768 2:87533569-87533591 CTTTGCTTTTAGCTTTGCCCTGG - Intergenic
934580562 2:95434466-95434488 CCCAGCTCCTGGCAGTGCCCAGG - Intergenic
934598887 2:95642251-95642273 CCCAGCTCCTGGCAGTGCCCAGG + Intergenic
936315062 2:111417225-111417247 CTTTGCTTTTAGCTTTGCCCTGG + Intergenic
936532234 2:113284244-113284266 CCCAGCTCCTGGCAGTGCCCAGG + Intergenic
937479040 2:122240408-122240430 CTCTGCTCCCAGCATTGACCAGG + Intergenic
938714124 2:134003258-134003280 CCCTGCCTCTAGCAGGGCTCTGG - Intergenic
938899410 2:135787195-135787217 CTCTGCTCCCACCACTGCCCTGG + Intergenic
941073548 2:160981804-160981826 TTCTGCTTCTAGGAGGCCCCAGG - Intergenic
941886722 2:170535687-170535709 CTCTGCTGCTAGCACTGTCATGG + Intronic
942640840 2:178059243-178059265 CTCTGTGTCTAGCAGGGTCCAGG + Intronic
944525655 2:200616367-200616389 CTCTGATGCCTGCAGTGCCCAGG - Intronic
948024802 2:234768550-234768572 CCCTGCTTCAAGCCATGCCCTGG + Intergenic
948542201 2:238699034-238699056 CTGTGCTTCCAGAAGGGCCCTGG - Intergenic
948672034 2:239574947-239574969 CTCTGCTCCAAGCACAGCCCAGG - Intergenic
948705004 2:239785149-239785171 CTCTGTTTTCAGCAGTGTCCAGG - Intronic
948846578 2:240685708-240685730 CTCAGCCTCTGGCAGAGCCCAGG + Intergenic
948847283 2:240689026-240689048 CTCAGCCTCTGGCAGAGCCCAGG - Intergenic
1168806414 20:674863-674885 CTCTCTTTCTTGCAGTCCCCAGG + Intronic
1169215104 20:3789022-3789044 CTTTGCCTGTAGCAGTGCACGGG + Intronic
1169342863 20:4809669-4809691 CTCTGCTTCTAGGAATCCCCTGG - Intronic
1171030149 20:21669669-21669691 CTCTGCTTGGGGCAGTGACCTGG - Intergenic
1171330415 20:24332493-24332515 CTCTGCTTTTGGCAGAGCCCAGG + Intergenic
1173161718 20:40657688-40657710 GTCTGCTTCTTGGAGTCCCCTGG + Intergenic
1173645032 20:44627928-44627950 CTCTGCTCCAAGCACTGACCCGG - Intronic
1174568907 20:51487162-51487184 CCCTGCTTCTCCCAGAGCCCAGG - Intronic
1174775516 20:53339788-53339810 CCCTTCCTCCAGCAGTGCCCAGG - Intronic
1175271770 20:57739097-57739119 CTCTGCCCCAGGCAGTGCCCAGG + Intergenic
1178686503 21:34715441-34715463 CTCCACTTCTGGCAGTGCCTTGG - Intronic
1178708168 21:34890606-34890628 CTCGGGTGCTGGCAGTGCCCAGG - Intronic
1178761556 21:35407610-35407632 CTCTGCTTCAAGCAGTGTGCTGG + Intronic
1180066185 21:45413725-45413747 CTTTGCTTCCCTCAGTGCCCAGG - Intronic
1180151630 21:45951224-45951246 CTCAGCTTCTAGAAGTAACCGGG + Intergenic
1182151662 22:28031439-28031461 GTCTGCTGCCTGCAGTGCCCTGG - Intronic
1183319905 22:37158793-37158815 CTTGGCTGCTAGCAGTGTCCAGG - Intronic
1184298489 22:43541199-43541221 CTCGGTTTCTGGCAGAGCCCAGG - Intronic
1184688784 22:46108219-46108241 CTCTGCTCCCAGCATTGCCCTGG - Intronic
949788177 3:7764362-7764384 CCCTGCCTGTGGCAGTGCCCTGG + Intergenic
950202755 3:11056634-11056656 CTCTGCCTCTGGCTGCGCCCTGG - Intergenic
952253840 3:31678867-31678889 CTCTGCTTCTATCTTTGCACTGG + Intronic
952953670 3:38543646-38543668 CTCTGCCTGTAGGAGTGCCTGGG + Intergenic
953618207 3:44510698-44510720 CTCTGCTTCTCCCTGGGCCCAGG + Intergenic
953979859 3:47408155-47408177 CACTGTTTCCAGCAGTGCCCTGG + Intronic
953999906 3:47548134-47548156 CTCTGCTTCCCACAGTGCACTGG - Intergenic
954418189 3:50404415-50404437 CTCTCATTCCAGCAGAGCCCCGG - Intronic
955203835 3:56877037-56877059 CTCTGCTTCTGGCAGTGAAGTGG - Intronic
955321539 3:57978069-57978091 CACTGCTCCTAGCTGTGGCCAGG - Intergenic
961135958 3:124511544-124511566 CTCTTCTTCTAGAAGCTCCCAGG - Intronic
961616153 3:128182805-128182827 CCCTGCTGCTAGCAGAGACCTGG + Intronic
963790432 3:149577558-149577580 CTCTGCTTAGAGAACTGCCCAGG + Intronic
963989153 3:151633444-151633466 CCCTGCATCCAGCAGTGCTCTGG - Intergenic
966086964 3:176079891-176079913 CTCTGCTTCTAGTGGTGAGCTGG - Intergenic
967226150 3:187293303-187293325 CTGTGCTTGTAGAAGTGTCCAGG + Intergenic
967440289 3:189499969-189499991 TTCTGGTTCTATCACTGCCCTGG + Intergenic
968201438 3:196759255-196759277 CTCTTCTTTTTGCATTGCCCTGG + Intronic
968693773 4:2010050-2010072 CCCAGCTGCTAGCAGTGCCCTGG + Exonic
981283092 4:142983835-142983857 CTCTGCATCTGGCAGGGCCAAGG - Intergenic
981578053 4:146225560-146225582 CTCTGCTTTTAGGAGTGTCTTGG - Intronic
981614594 4:146633764-146633786 CTCTGCATCCAGTAGTTCCCAGG - Intergenic
982187213 4:152814773-152814795 CTGTGCATCCAGCAGTGGCCAGG - Intronic
983149532 4:164261104-164261126 CTCTGCTTCCAGTAGTTCCTTGG - Intronic
984831792 4:183982791-183982813 CTCTGCTTCTCTCTGTTCCCTGG + Intronic
986065574 5:4230714-4230736 CGCTGCTTTTCCCAGTGCCCTGG - Intergenic
991012898 5:61902149-61902171 CTCTGCCTCTGTCATTGCCCTGG + Intergenic
991441099 5:66650194-66650216 CTCTGCTTCAAGCTGTGGTCTGG + Intronic
991617562 5:68513088-68513110 CTCTGTTTCTGGCATTGTCCTGG + Intergenic
995201025 5:109425409-109425431 CCCTGCTTCCCTCAGTGCCCTGG + Intergenic
995902613 5:117087818-117087840 CTCTGCTTTTAGTCTTGCCCTGG + Intergenic
997758201 5:136420262-136420284 CTGTGCTTCTCTCAGTGCCAGGG + Intergenic
999113603 5:149142354-149142376 GTCTCCTTCTAGCACTGCCTGGG + Intronic
999251578 5:150185517-150185539 CTCTCCTCCTACCAGTGGCCTGG + Intergenic
999893557 5:156004861-156004883 CTCTGGTTCCAGGAGTGCACGGG + Intronic
1002569055 5:180129749-180129771 CACTGCCTCTGCCAGTGCCCAGG + Intronic
1002608793 5:180400185-180400207 CTATGCTCCTGGCAGTGGCCTGG + Intergenic
1002841806 6:912882-912904 CTCTGCTTAATGCATTGCCCAGG - Intergenic
1003398823 6:5775160-5775182 CTCTGCTCCTGGCTTTGCCCAGG + Intergenic
1006426049 6:33963567-33963589 ATCTGCCTTTAGCAGGGCCCTGG - Intergenic
1009386316 6:63086835-63086857 CTCTGCTTCTCCCAGTGCTTAGG - Intergenic
1011993389 6:93552550-93552572 CTCTGCTTCAAGCTGTGGTCAGG - Intergenic
1013153818 6:107473866-107473888 CTCTGCTTCCAGCTGTGAGCAGG - Intergenic
1013394193 6:109718055-109718077 TTCTGCTTCTAGGAGGCCCCAGG + Intronic
1013773674 6:113654594-113654616 CTGTGCTGCTGGCAGTGCCCTGG - Intergenic
1013798559 6:113912460-113912482 CTGTGCTTCTGGGAGTGCCTGGG - Intergenic
1016307395 6:142698191-142698213 CTCTGGTTCTAGCAGCGGGCGGG - Intergenic
1017048223 6:150366779-150366801 CTCTGCTCCTAGGAGGTCCCAGG - Intergenic
1018251253 6:161872776-161872798 CTCTGCTTCCTGGAGAGCCCAGG + Intronic
1018712463 6:166506638-166506660 CTCTGCGTCCAGCAGTCCCTTGG - Intronic
1018998310 6:168726753-168726775 AACTGCTTGTAGCAGAGCCCAGG + Intergenic
1019542949 7:1559689-1559711 CTCTGCTTCTGGGATTCCCCCGG + Intronic
1019688275 7:2394723-2394745 CTCTGCTTCAAGCTGAGGCCTGG + Intergenic
1019779513 7:2931106-2931128 CTCTGCTTCCTGCAGGCCCCAGG + Intronic
1020520087 7:9174162-9174184 CTCTCCCTCTCCCAGTGCCCAGG + Intergenic
1022143019 7:27509526-27509548 CTCTGCTTCTTGGAGTGCTCTGG + Intergenic
1022886374 7:34650574-34650596 ATCTGCTTTTAGCTGTGACCTGG - Intergenic
1023990319 7:45124765-45124787 CTCTGCTCCTCGCAGAGCTCTGG + Intergenic
1024977266 7:55125436-55125458 CCTGGCTTCTGGCAGTGCCCTGG - Intronic
1025752536 7:64306276-64306298 CTCTGCTTTTAGCAGATCCCGGG + Intergenic
1029612958 7:101637099-101637121 CCCTGCTTCTGGCAGACCCCCGG - Intergenic
1034222436 7:149456884-149456906 CTCTGCTTATAGCAGAAGCCAGG - Intronic
1034674345 7:152881861-152881883 CTCTGCTCCTTGCGGTGTCCTGG + Intergenic
1034715541 7:153238116-153238138 CTGTGCCTCTAGCAGAACCCAGG - Intergenic
1035164923 7:156981365-156981387 CCCTTCTCCTAGCAGTCCCCAGG + Intergenic
1035219302 7:157396466-157396488 CTCTGCCTCCAGCAAAGCCCAGG + Intronic
1035530356 8:346059-346081 CTCTGCTTCTCTGAGAGCCCTGG + Intergenic
1035742647 8:1939726-1939748 CTCTGCTTCCAGCAGCCCCTTGG - Intronic
1036014921 8:4772204-4772226 CTCTGCTTCCAGCAGCAGCCTGG + Intronic
1036641773 8:10589305-10589327 CTCTGCTTCTGCCAGTGTCGAGG + Intergenic
1037410552 8:18591370-18591392 CTTTGTTCTTAGCAGTGCCCAGG - Intronic
1037721090 8:21444687-21444709 CTCTGCTTCCAGCCGGGGCCAGG - Intergenic
1039150016 8:34493993-34494015 CTCAGCTTGTAACAGTTCCCAGG - Intergenic
1041295957 8:56357564-56357586 CTCAGTTTCTAGGGGTGCCCTGG + Intergenic
1045260973 8:100574188-100574210 CTCTGCATCTTTCAGGGCCCTGG + Intronic
1048541586 8:135346969-135346991 CTCCAGTGCTAGCAGTGCCCTGG + Intergenic
1061768267 9:132896630-132896652 CTCTGCTTCCACTACTGCCCCGG + Exonic
1061795544 9:133083884-133083906 CTTTGCTTCTAGCGGGGCCGTGG - Intronic
1061968093 9:134027285-134027307 CCAAGCATCTAGCAGTGCCCGGG - Intergenic
1062422117 9:136487788-136487810 CCCAGCTCCTAGCAGTGCCTGGG - Intergenic
1193524853 X:82576548-82576570 CTCTTATTCTATCAGTGACCTGG + Intergenic
1196697310 X:118626886-118626908 ACCTTCTTCTAGCATTGCCCTGG + Intronic
1199452275 X:147990248-147990270 CTCTGCTCCTTGCACTTCCCAGG + Intronic
1199850890 X:151724395-151724417 CTCTGCTTTGAGCAGGGCCCAGG - Intergenic
1201424519 Y:13833599-13833621 TTCTGCTTCTAGACCTGCCCTGG + Intergenic