ID: 1093126191

View in Genome Browser
Species Human (GRCh38)
Location 12:15331077-15331099
Sequence GGCCGGAAGGGGGTCTTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 184}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093126181_1093126191 9 Left 1093126181 12:15331045-15331067 CCTAGCAGAGAGAAAGGGAGTGA 0: 1
1: 1
2: 3
3: 49
4: 476
Right 1093126191 12:15331077-15331099 GGCCGGAAGGGGGTCTTGAGAGG 0: 1
1: 0
2: 2
3: 16
4: 184
1093126179_1093126191 11 Left 1093126179 12:15331043-15331065 CCCCTAGCAGAGAGAAAGGGAGT 0: 1
1: 0
2: 3
3: 20
4: 231
Right 1093126191 12:15331077-15331099 GGCCGGAAGGGGGTCTTGAGAGG 0: 1
1: 0
2: 2
3: 16
4: 184
1093126180_1093126191 10 Left 1093126180 12:15331044-15331066 CCCTAGCAGAGAGAAAGGGAGTG 0: 1
1: 0
2: 1
3: 25
4: 356
Right 1093126191 12:15331077-15331099 GGCCGGAAGGGGGTCTTGAGAGG 0: 1
1: 0
2: 2
3: 16
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093126191 Original CRISPR GGCCGGAAGGGGGTCTTGAG AGG Intronic
900157985 1:1211211-1211233 GGCTGGACAGGGGTCTTGGGAGG - Intergenic
900344566 1:2204901-2204923 GGGAGGGAGGGGGGCTTGAGGGG - Intronic
901198246 1:7452238-7452260 GGGCGGAGGGGGGCCTGGAGAGG - Intronic
901790833 1:11653163-11653185 GGCCGGAGGGAGGGCTGGAGAGG - Intronic
906204647 1:43980241-43980263 GGCAGGAAGGGGGTCTTGCCTGG - Intronic
907787796 1:57630259-57630281 AGCTGGAAGGAGATCTTGAGAGG + Intronic
915514218 1:156403361-156403383 GGCCTGAGGGGGAACTTGAGGGG - Intergenic
915531459 1:156504795-156504817 GGCCTGAAGTGGGACTTGTGCGG - Intergenic
915598080 1:156906600-156906622 GGCGGGAAGGGGGTCACCAGGGG - Intronic
917188507 1:172388624-172388646 GGCCGGATGTGGGCCTTGCGAGG - Exonic
918980579 1:191553091-191553113 TGCTGGGAGGGGATCTTGAGTGG - Intergenic
919833223 1:201556525-201556547 GGCAGGAAGGGCCTCTTGGGAGG + Intergenic
920350746 1:205336468-205336490 GGGCGGAAGGGTGTCTTGAGGGG - Exonic
920691347 1:208148798-208148820 GGCCTGAAGGAGGCCCTGAGGGG + Intronic
922070955 1:222193064-222193086 GGCCGCAAGTGGATCATGAGAGG - Intergenic
922100161 1:222472760-222472782 GGCTGCAAGTGGGTCTGGAGAGG + Intergenic
922734278 1:227971152-227971174 GGCTGCAAGTGGGTCTGGAGAGG - Intergenic
922734563 1:227972283-227972305 GGCTGCAAGTGGGTCTGGAGAGG - Intergenic
922734848 1:227973425-227973447 GGCTGCAAGTGGGTCTGGAGAGG - Intergenic
1066658095 10:37713149-37713171 GGCCTGAAGGGGGCCTTGGCTGG + Intergenic
1066733110 10:38451104-38451126 GGCTGCAAGTGGGTCTGGAGAGG - Intergenic
1067141371 10:43659880-43659902 GGCCGCAAGCCGGTCTTTAGGGG - Intergenic
1069591273 10:69643876-69643898 TGCAGGAGGGGGGTCTAGAGGGG - Intergenic
1069615036 10:69801647-69801669 GGCAGGAAGGGGGTGTGGAGTGG - Intergenic
1070156300 10:73837664-73837686 AGCAAGAAGGGGATCTTGAGTGG + Intronic
1070933560 10:80277116-80277138 GGCCAGCACAGGGTCTTGAGTGG - Intronic
1072005945 10:91247584-91247606 GGCAGGAAGGGGGTGTTGTGGGG + Intronic
1073566070 10:104536659-104536681 GGGCAGGAGGGGGTCTGGAGAGG + Intergenic
1073931331 10:108580222-108580244 GGCAGGAAGGGGGTCTTTTCAGG - Intergenic
1076504022 10:130960014-130960036 GGCAGGAAGTGGGGCTGGAGAGG - Intergenic
1085277026 11:75306952-75306974 GGCTGGAAGGGAAACTTGAGGGG - Intronic
1086454974 11:86952226-86952248 GGCTGGATGGGGGTTTTGTGAGG + Exonic
1086889547 11:92240928-92240950 GGCAGGAAGGGGGGCATGGGGGG - Intergenic
1088096379 11:106105685-106105707 GGCAGGTAAGAGGTCTTGAGAGG - Intergenic
1088700804 11:112409519-112409541 GGCCAGAATGGGGTCTTCTGAGG + Intergenic
1090806309 11:130204519-130204541 GGCCAGAAGGGGGCCTGGCGCGG + Intronic
1093126191 12:15331077-15331099 GGCCGGAAGGGGGTCTTGAGAGG + Intronic
1095898229 12:47301899-47301921 GGCAAGAAGGGGGTCTTTTGGGG + Intergenic
1096689326 12:53309708-53309730 AGCCAGAAGAGGGTCTGGAGGGG + Exonic
1096977517 12:55707934-55707956 GGCCGGAGGCGGGGCCTGAGTGG - Intronic
1102347782 12:112170509-112170531 GACCGGAAGAGAGTCTTGGGGGG - Intronic
1103567447 12:121823569-121823591 GGCCGGAAGAGGGGCTGGGGTGG - Exonic
1103974974 12:124696543-124696565 GGCTGGAAGGGGGTTTTGAGTGG - Intergenic
1104879984 12:132064015-132064037 GGCCGGGGGGGGGTCATCAGTGG - Intronic
1104934329 12:132356444-132356466 GGCCGGGCAGGGGTCTTGGGTGG - Intergenic
1105743433 13:23353208-23353230 GGCAGGAAAAGGGTCTTGCGGGG - Intronic
1106038030 13:26063041-26063063 GGCCAAAAGTTGGTCTTGAGAGG + Intergenic
1108134355 13:47339316-47339338 GGCAAGAAGGGGGTCTTTTGAGG - Intergenic
1112300174 13:98222932-98222954 GGCCGGAAGGTGCTCTTAAGTGG + Intronic
1118198323 14:63648729-63648751 GGCAAGAAGGGGGTCTTTATGGG + Intergenic
1118619318 14:67600271-67600293 TGCCGGAAGCGGGTCTGGAGCGG - Exonic
1119431613 14:74571674-74571696 GGCCTGGCTGGGGTCTTGAGAGG + Intronic
1122176642 14:99925758-99925780 GGCCGGAAGGGTGTCTGAATAGG + Intronic
1124625181 15:31303608-31303630 GGCTGGAAGAGGGGCTTCAGGGG + Intergenic
1125530968 15:40413115-40413137 GCCTGGAAGGGGGTCAGGAGAGG - Intronic
1127638563 15:60893931-60893953 GCCCAGACGGGGGACTTGAGAGG - Intronic
1128234975 15:66060986-66061008 GGCTGGAATGGGGACTGGAGGGG + Intronic
1132640756 16:977327-977349 CTCCCGAAGGGGGTCTTGAGAGG + Intronic
1132756661 16:1488507-1488529 GGCTAGAAGGGGGTCTGGAAGGG - Intronic
1133266175 16:4585539-4585561 GGCTGGGAGGGGGCCTGGAGTGG + Intronic
1133829302 16:9306897-9306919 TGCCTGAATGGGGTTTTGAGGGG - Intergenic
1134588594 16:15434239-15434261 AGCCGGCAGCGGGTTTTGAGTGG - Intronic
1135732768 16:24908225-24908247 GGCTGGAATTGGGTGTTGAGAGG + Intronic
1140304946 16:73794285-73794307 GGCTGGGAGGGGGTCTGGGGTGG - Intergenic
1140475109 16:75235825-75235847 GGCCGGCGGGGAGTCTGGAGGGG + Exonic
1142594510 17:1022998-1023020 GGCCGGCAGAGGCTCTGGAGCGG - Intronic
1143007350 17:3845827-3845849 CGCCGGAAATGGGTGTTGAGGGG - Intronic
1143716000 17:8769456-8769478 GGCCGGAACGGTGTCTGGTGAGG - Intergenic
1143995865 17:11005980-11006002 GACTCAAAGGGGGTCTTGAGGGG - Intergenic
1144457863 17:15433597-15433619 GTCCTAAAGGGGGTCTTCAGAGG - Intergenic
1147746440 17:42697643-42697665 GTTCGGAAGTGGGTCTTGAGGGG - Exonic
1147922652 17:43927528-43927550 GGCGGGAAGGGGACCTTGGGCGG - Intergenic
1151243325 17:72775222-72775244 GGCTGCAAGGGGGTCCTCAGTGG - Intronic
1151623450 17:75261653-75261675 GGCCTGCATGGGGTCCTGAGAGG + Exonic
1151769564 17:76151140-76151162 GGCAGGAAGGGGGTCTTCCCTGG + Intronic
1154166053 18:12015297-12015319 GGCTGGAAGTGGGTCAAGAGGGG - Intronic
1156859423 18:41818683-41818705 AGCAGGAAAGAGGTCTTGAGAGG - Intergenic
1157942926 18:51949013-51949035 GGCTGGAAGGGTGTATTTAGTGG - Intergenic
1158292001 18:55953631-55953653 GGCAGGATGGGGGTGTTCAGTGG - Intergenic
1159488566 18:69099118-69099140 AGGAGGAAGGGGGACTTGAGTGG + Intergenic
1161161984 19:2766968-2766990 GGACGGAAGGGGGACTGGCGAGG - Intronic
1161604383 19:5206600-5206622 GGCCGGTGGGGGGGCTCGAGGGG + Exonic
1163674764 19:18650054-18650076 GGCCTGGAGGAGATCTTGAGGGG + Intronic
1167080030 19:47272030-47272052 GGCGGGAAAGGGGGCTTGACTGG + Intergenic
1167126041 19:47549370-47549392 GTCCAGAAGTGGGTTTTGAGGGG + Exonic
1168228830 19:55015647-55015669 AGAAGGAAGGGGGTCTGGAGAGG + Intronic
926141911 2:10372905-10372927 GGCCAGAAGAGGGGCTTTAGAGG - Intronic
927126500 2:20016564-20016586 GGCCACAAGGGGGTCTTGAAAGG + Intergenic
932412380 2:71555011-71555033 GGAGGGAAGGGGGACTGGAGAGG + Intronic
934560633 2:95311528-95311550 GGCTTGATGGGGGTCATGAGTGG + Intronic
938930937 2:136086447-136086469 GGCAGGAAGGGGTTGTGGAGGGG + Intergenic
944796001 2:203186004-203186026 TGGGGGAAGGGTGTCTTGAGAGG - Intronic
1170400122 20:15973094-15973116 TGCCGGGAGGGGGCCATGAGAGG + Intronic
1173534374 20:43798135-43798157 GGGTGGAAGGGGATCTTGGGTGG + Intergenic
1173965105 20:47106734-47106756 GGATGGAAGGGGGTTTTCAGAGG - Intronic
1179892729 21:44345102-44345124 GGCCTGGAGGGGGTCTGGACTGG - Intergenic
1183333079 22:37231775-37231797 GGCTGGCAGAGGGACTTGAGGGG - Intronic
1183485689 22:38086584-38086606 GACCGGAGGGAGGTCCTGAGAGG + Intronic
1184307760 22:43618383-43618405 GGCAGTATGAGGGTCTTGAGAGG + Intronic
1184988712 22:48153375-48153397 AGGCGGCAGGGGGTCTTGGGAGG + Intergenic
1185151735 22:49167645-49167667 GGCGGGGAGGGGGTGTGGAGGGG + Intergenic
1185309473 22:50146124-50146146 GGCCTGAAAGGGGTGGTGAGGGG + Intronic
950290203 3:11777925-11777947 GGCCGGAAGTGGGTAATGGGGGG - Intergenic
953731956 3:45457318-45457340 GGCAGGAAGAGGGTCTGGAGGGG + Intronic
953980520 3:47410863-47410885 GGCTGGCAGAGGGTCTTGAGCGG - Exonic
954191512 3:48965660-48965682 GGCCGGACTGGGGTCTTTAAAGG - Intronic
954368817 3:50159684-50159706 GGCCGGGAGGTGGTCCTGGGTGG - Exonic
954996635 3:54887900-54887922 GGCTGGAAGAGGGGCATGAGAGG - Intronic
955343057 3:58140545-58140567 TGGCGGAAGAGGGTGTTGAGAGG + Intronic
957760347 3:84548188-84548210 GGCCGGAGGGGGGTCTCCAAAGG - Intergenic
959076701 3:101756474-101756496 GGACTGAAGGGGGTCTGAAGAGG - Intronic
960940234 3:122928554-122928576 GGCCGGAAGGTGTTCATGTGTGG - Exonic
962498342 3:135965543-135965565 GGCAGGAAGGGGGCCTCCAGGGG - Intergenic
968771814 4:2512343-2512365 GGAAGGAAGAGGGTCTTAAGAGG + Intronic
971913070 4:32821780-32821802 GGCAGAAAGAGGGTGTTGAGAGG - Intergenic
976593936 4:86876359-86876381 GGCCGGGAGCGGGTCCTGGGCGG + Intronic
978310653 4:107381958-107381980 GTCCCAATGGGGGTCTTGAGTGG - Intergenic
979259443 4:118634052-118634074 GGCTGCAAGTGGGTCTGGAGAGG - Intergenic
980972671 4:139581502-139581524 GGCAAGAAGGGAGTCTTGTGGGG + Intronic
982474624 4:155834965-155834987 AGCCAGAAGGGGGTATGGAGTGG - Intronic
983521421 4:168712817-168712839 GGCAGGAAGGGCTTCTTTAGGGG + Intronic
986593811 5:9399741-9399763 TGACGGAAAGGGGCCTTGAGGGG + Intronic
988751620 5:34193445-34193467 GGCCGGAAGGGGATCTGAGGAGG - Intergenic
991736243 5:69632936-69632958 GGCCGGAAGGGGATCTGAGGAGG - Intergenic
991815698 5:70509052-70509074 GGCCGGAAGGGGATCTGAGGAGG - Intergenic
993280411 5:85919328-85919350 GGCCAGAAGGGGGAATGGAGTGG + Intergenic
995229613 5:109744276-109744298 GGCAAGAAGGGGGTCTTGGAAGG + Intronic
997530030 5:134576448-134576470 GGCTGGAAGGGAGTCTGGACAGG - Intronic
1001909342 5:175502321-175502343 GGCAAGAAGGGGGTCTTGGGGGG + Intronic
1002209005 5:177584756-177584778 TGCTGGACGTGGGTCTTGAGGGG - Intergenic
1002871558 6:1171043-1171065 GGCAGGAAGGGGGACGTGAGAGG - Intergenic
1004604536 6:17181703-17181725 GTCTGGAAGGGGGTCATGAGTGG - Intergenic
1006914482 6:37585511-37585533 GGGTGAATGGGGGTCTTGAGAGG - Intergenic
1007288513 6:40765924-40765946 GGCAGGAAGAGGGTGTGGAGGGG - Intergenic
1016371027 6:143374269-143374291 GACTCAAAGGGGGTCTTGAGAGG + Intergenic
1018955558 6:168407989-168408011 GGCCCCAAGGGGGTCGTGATAGG - Intergenic
1022999822 7:35797252-35797274 AGCCAGAAGGGGGTCCTGAAAGG + Intergenic
1023401170 7:39793676-39793698 GGCTGCAAGTGGGTCTGGAGAGG - Intergenic
1023889120 7:44380266-44380288 GGCAGGCAGAGGGTCTAGAGAGG - Exonic
1024074341 7:45811049-45811071 GGCTGCAAGTGGGTCTGGAGAGG - Intergenic
1024074674 7:45812407-45812429 GGCTGCAAGTGGGTCTGGAGAGG - Intergenic
1024709195 7:51996154-51996176 GGCCAGGCAGGGGTCTTGAGAGG + Intergenic
1025052294 7:55741474-55741496 GGCTGCAAGTGGGTCTGGAGAGG + Intergenic
1025053073 7:55744479-55744501 GGCTGCAAGTGGGTCTGGAGAGG + Intergenic
1025129249 7:56367157-56367179 GGCTGCAAGTGGGTCTGGAGAGG + Intergenic
1025131227 7:56375145-56375167 GGCTGCAAGTGGGTCTTTAGAGG + Intergenic
1025178268 7:56812666-56812688 GGCTGCAAGTGGGTCTGGAGAGG + Intergenic
1025178612 7:56814084-56814106 GGCCGGAACTGGGCCTGGAGAGG + Intergenic
1025179138 7:56816198-56816220 GGCTGCAAGTGGGTCTGGAGAGG + Intergenic
1025179593 7:56818084-56818106 GGCTGCAAGTGGGTCTGGAGAGG + Intergenic
1025180043 7:56819922-56819944 GGCTGCAAGTGGGTCTGGAGAGG + Intergenic
1025180514 7:56821904-56821926 GGCTGCAAGTGGGTCTGGAGAGG + Intergenic
1025180874 7:56823429-56823451 GGCCGGAACTGGGCCTGGAGAGG + Exonic
1025180961 7:56823751-56823773 GGCTGCAAGTGGGTCTGGAGAGG + Intronic
1025181833 7:56827331-56827353 GGCTGCAAGTGGGTCTGGAGAGG + Intergenic
1025690084 7:63749664-63749686 GGCTGCAAGTGGGTCTGGAGAGG - Intergenic
1025690531 7:63751487-63751509 GGCTGCAAGTGGGTCTGGAGAGG - Intergenic
1025690978 7:63753310-63753332 GGCTGCAAGTGGGTCTGGAGAGG - Intergenic
1025691416 7:63755086-63755108 GGCTGCAAGTGGGTCTGGAGAGG - Intergenic
1025691853 7:63756909-63756931 GGCTGCAAGTGGGTCTGGAGAGG - Intergenic
1025692302 7:63758732-63758754 GGCTGCAAGTGGGTCTGGAGAGG - Intergenic
1025692748 7:63760555-63760577 GGCTGCAAGTGGGTCTGGAGAGG - Intergenic
1025693164 7:63762234-63762256 GGCTGCAAGTGGGTCTGGAGAGG - Intergenic
1025693609 7:63764057-63764079 GGCTGCAAGTGGGTCTGGAGAGG - Intergenic
1025694086 7:63766044-63766066 GGCTGCAAGTGGGTCTGGAGAGG - Intergenic
1026962626 7:74418212-74418234 GGCTGGGAGGGGGTCTAGACGGG - Intergenic
1027189402 7:75988716-75988738 GGCCGGGTGGGGGGCTGGAGGGG + Intronic
1027189427 7:75988769-75988791 GGCCGGGTGGGGGGCTGGAGGGG + Intronic
1027189454 7:75988819-75988841 GGCGGGGAGGGGGTGTGGAGGGG + Intronic
1027189466 7:75988844-75988866 GGCGGGGAGGGGGTGTGGAGGGG + Intronic
1027229714 7:76265093-76265115 GGGCTGAGGGGGGTCTTGGGAGG + Intronic
1027432538 7:78129644-78129666 GGCCGGAAGTGATTCTTGAAGGG - Intronic
1031498097 7:122476971-122476993 GGCGGGAAGGGGGGCGGGAGGGG + Intronic
1035170045 7:157011962-157011984 GACCGGAAGGGGCTGTGGAGAGG + Intergenic
1035209322 7:157316213-157316235 GGCCAGAAGGGGGTCTTTTTGGG - Intergenic
1037894437 8:22642331-22642353 GGCCGGGAGGGGGTGGTGGGTGG + Intronic
1040015288 8:42694542-42694564 GCCTGGAAGAGGGTCTTTAGTGG - Intergenic
1043079136 8:75742867-75742889 GGACTGGAGGGGGTCTTGAGAGG + Intergenic
1048956453 8:139541127-139541149 GGCAGGATGGGGGTCTTGGTAGG - Intergenic
1048995989 8:139794048-139794070 GGCAGGAAGGGGGTCAGCAGGGG - Intronic
1049578872 8:143401801-143401823 GCCGGGAAGGGGGTGCTGAGGGG - Intergenic
1049671605 8:143872544-143872566 GAGCGGAAGGTGATCTTGAGGGG + Exonic
1049702414 8:144021210-144021232 TGAGGGAAGGCGGTCTTGAGGGG - Intronic
1049703052 8:144023705-144023727 TGAGGGAAGGGGGTCTTGAGGGG - Intronic
1049703286 8:144024515-144024537 TGAGGGAAGGGGGTCTTGAGGGG - Intronic
1049812680 8:144582523-144582545 GGCCTGAAGGAGGGCTTGGGTGG - Intronic
1057445522 9:95111836-95111858 GGCCTCACGGGGGTCCTGAGAGG - Intronic
1057840847 9:98484574-98484596 GGCTGGATGGGGATCTTGGGGGG + Intronic
1059560885 9:115333621-115333643 GGGGGGAAGGGGGTCTTGGCAGG - Intronic
1060934088 9:127505897-127505919 AGCCGGACGGGGCTCCTGAGGGG - Exonic
1061211454 9:129195784-129195806 GGCCAGAAGGGCGTCTCCAGAGG - Intergenic
1062517030 9:136941973-136941995 GGCCGGGCAGGGGTCCTGAGGGG - Intronic
1185440735 X:226485-226507 GGCCCGAAGGGGGTCCCGACAGG - Intergenic
1186450684 X:9671097-9671119 GGCCTGAGGGTGGTCTTGGGGGG - Intronic
1187975137 X:24697314-24697336 GGCATCAAGGGAGTCTTGAGGGG + Intronic
1189102764 X:38208295-38208317 GGCCACAAGGGGGTCTTCAAGGG - Intronic
1190422832 X:50302611-50302633 GGCAGGTTGGGGGTATTGAGAGG - Intronic
1191943165 X:66501455-66501477 GGCTGAAAGTGGGTCTTGACAGG + Intergenic
1193379953 X:80808026-80808048 GGGAGGAAGGGGCTCTGGAGGGG - Intronic
1197333467 X:125182043-125182065 AGCCTGAAGTGGGTCTTGATAGG + Intergenic
1201404459 Y:13635780-13635802 GGCTGGAAAGGGGTGTTGGGAGG - Intergenic
1202380958 Y:24276418-24276440 GGCTGCAAGTGGGTCTGGAGAGG - Intergenic
1202489827 Y:25393708-25393730 GGCTGCAAGTGGGTCTGGAGAGG + Intergenic