ID: 1093131781

View in Genome Browser
Species Human (GRCh38)
Location 12:15400358-15400380
Sequence GTGCAGCAGGTGAGGCTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 369}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093131781 Original CRISPR GTGCAGCAGGTGAGGCTGCT GGG (reversed) Intronic
900181367 1:1312464-1312486 GTGCAGGAGCCGAGGCTTCTTGG + Exonic
900279993 1:1860777-1860799 GAGCAGTAGGTGAGGCTTTTGGG - Intronic
900349820 1:2228969-2228991 GTGCAGCACGGGCGGCGGCTCGG - Exonic
900477144 1:2881399-2881421 CTGCAGCCGGCGGGGCTGCTGGG + Intergenic
900539791 1:3196981-3197003 GTGCAGCCGCTGAGGCTGGGGGG + Intronic
900567316 1:3339897-3339919 GTGCAGCAGCTGAGGTTGGAAGG + Intronic
901380848 1:8873027-8873049 GTGCAGCAGGGAACACTGCTGGG - Intronic
901456240 1:9364459-9364481 GTGCTCCAGGTCAGGCTGCGGGG + Intronic
901882405 1:12202007-12202029 GATCAGCAGGTGCTGCTGCTCGG - Exonic
902060848 1:13641198-13641220 GAGCAGCAGGAGAGGAGGCTGGG + Intergenic
902623655 1:17664582-17664604 GTGCAGTACCTGAGGCTGCAGGG - Exonic
902650229 1:17832600-17832622 GAACACCAGGTGGGGCTGCTGGG + Intergenic
902875200 1:19336810-19336832 GTCCTGCAGCAGAGGCTGCTAGG - Intergenic
903127167 1:21256089-21256111 GTCCAGCTGGGGAAGCTGCTGGG - Exonic
904300953 1:29554912-29554934 GTGCAGCAGGTGGAGCCACTGGG - Intergenic
904396887 1:30228118-30228140 GGGCAGCAGGGGACACTGCTGGG + Intergenic
904928598 1:34068008-34068030 GTGCAGAAGTTGGGGCTTCTAGG - Intronic
905183485 1:36180154-36180176 GTGGAGCAGGAGAGGGTGCCTGG - Intronic
906038517 1:42767616-42767638 GTGCAGAAGGTGAGGAGGCGCGG + Exonic
906096496 1:43227750-43227772 GCCCAGCAGGGGAGGCTGATGGG - Intronic
907278527 1:53329854-53329876 GTGCCTCAGGTGAGGCTGGAGGG + Intergenic
908200244 1:61787918-61787940 GGGCAACAGGTAAGGCTGCAGGG - Exonic
908739538 1:67312853-67312875 GTGCAGCTGACGAGGCTGCCTGG - Intronic
910257153 1:85259564-85259586 GAGCAGCAGCTCAGGCTCCTCGG - Exonic
911254976 1:95622734-95622756 TTGCAGGAGGTCAGGCTGCCTGG - Intergenic
911711417 1:101077970-101077992 GTGCAGGAGGTGAGGAGGCAGGG + Intergenic
912657730 1:111502963-111502985 GGGCAGCAATTGAGGCAGCTGGG - Intronic
915363524 1:155300675-155300697 CTGCATAGGGTGAGGCTGCTGGG - Intronic
915892241 1:159782889-159782911 GTGCAGCAGGTGGGCCTACACGG - Intergenic
916853459 1:168726936-168726958 CAGCAGCAGGTGAGGGTGCCGGG - Intronic
917078205 1:171228194-171228216 GTGAAGCAGGCTAGGCTTCTGGG + Intergenic
917660108 1:177170033-177170055 GTGAAGCAGGTGCTGTTGCTGGG - Intergenic
918263748 1:182820802-182820824 GTGCTGGAGGTGGGGCTGGTGGG - Intronic
918283072 1:183023997-183024019 GTGCTGCAGGTGGGGCTGCCCGG - Exonic
920029544 1:203028247-203028269 GTGCATGAGGTCTGGCTGCTGGG + Intronic
921613774 1:217242886-217242908 AAGCAGCAGCTGAGGCTACTGGG + Intergenic
922072020 1:222204114-222204136 GTACACAAGGTCAGGCTGCTGGG + Intergenic
922649386 1:227324057-227324079 GTCCAGCAGCTGATGCTGCCTGG - Intergenic
922770070 1:228176871-228176893 CTGCAGCGGGTGAGGCTGGACGG - Exonic
923305522 1:232684841-232684863 GTGGTGCAGCTGATGCTGCTAGG - Intergenic
923660378 1:235952068-235952090 GTGCAGCAGGTCAGTCTGGTGGG - Intergenic
924374587 1:243391823-243391845 GTGCAGGAGGTGGGGGTGGTAGG + Intronic
1062987805 10:1785625-1785647 ATGGAGCAGGTGAGTCTGCTCGG + Intergenic
1063197274 10:3755314-3755336 GGTTAGCAGGTGAGGATGCTGGG + Intergenic
1063387608 10:5625896-5625918 GGGCAGCAGGTGAAGCCCCTTGG + Intergenic
1064334819 10:14429552-14429574 GTGCTGTAGCTAAGGCTGCTTGG + Intronic
1065535139 10:26708877-26708899 GTGAAGCAGGTCAGGCGGGTGGG - Intronic
1065901822 10:30214866-30214888 GGGCAGCAGGTGGGGCAGCGGGG - Intergenic
1067159262 10:43809351-43809373 GGGCAGCAGGTCAGGCTGTGGGG - Intergenic
1068179404 10:53500890-53500912 GGGCAGCAGGAGCGGCTGCATGG + Intergenic
1069034109 10:63630175-63630197 GTGCATCAGATGTGGCTCCTGGG - Intergenic
1069784844 10:70981364-70981386 GTGCACCAGGTGTGGCTCCAGGG + Intergenic
1070287208 10:75092786-75092808 GTGCAGAATCTGAGGCTGCAGGG - Intergenic
1070540545 10:77412410-77412432 CAGCAGCATGTGGGGCTGCTGGG - Intronic
1072625461 10:97108211-97108233 GTGCAGCAGGGGAGGTGGGTAGG + Intronic
1074310930 10:112322810-112322832 ATGTAGCAGCTCAGGCTGCTTGG - Intergenic
1074557742 10:114507622-114507644 GTACAGCAGGTGTGGCTGGCAGG - Intronic
1076065942 10:127448014-127448036 CAGCACCAGGTGAGGCTGCCTGG - Intronic
1076461466 10:130650125-130650147 ATGCTGCAGGTGAGGGGGCTGGG + Intergenic
1076734505 10:132452689-132452711 GTGCAGCAGGACGGGCTACTTGG - Intergenic
1077654529 11:4006077-4006099 GTGCTGGAGGTGGGGCTGTTAGG + Intronic
1078355704 11:10629992-10630014 GTGCCGGAGGTAAGGCTCCTGGG - Intronic
1078495381 11:11811652-11811674 GCTTAGCAGGTGGGGCTGCTCGG - Intergenic
1079137487 11:17784112-17784134 CTGCAGCAGCGGAGGCTACTTGG - Intergenic
1079987866 11:27217303-27217325 GTTTAACAGGTGAGGTTGCTGGG - Intergenic
1080873807 11:36259249-36259271 ATGCTGGAGGTGGGGCTGCTGGG - Intergenic
1081751779 11:45516417-45516439 GTGCTGGAGGTGAGCCTGGTGGG + Intergenic
1081773046 11:45661515-45661537 CGGCAGCAGCTGGGGCTGCTTGG + Intronic
1082110293 11:48266609-48266631 CTTCTGCAGGTGAGGCTCCTTGG + Intergenic
1082687835 11:56260983-56261005 CTGCAGCAGGGGAGGCAGCTGGG - Intergenic
1083173286 11:60935156-60935178 GGGCAGCCCGTGAGGGTGCTGGG + Intronic
1083307935 11:61770477-61770499 GTGCAGCATCTGGGACTGCTGGG - Exonic
1083402191 11:62431175-62431197 GTGCAGCAGTGGATGATGCTCGG + Intergenic
1083603073 11:63961027-63961049 TTGCAGCAGGTGAGGCTGACGGG + Intergenic
1083887422 11:65579629-65579651 ATGCAGCATGAGAGGCAGCTGGG + Intronic
1084189710 11:67493396-67493418 GTGCAGGAGGTGCGGCGGCTGGG - Exonic
1084327799 11:68411757-68411779 CAGCAGAGGGTGAGGCTGCTGGG - Intronic
1084393117 11:68891493-68891515 GTGCAGCAGGGGACGTTGCCGGG - Intronic
1085300578 11:75456018-75456040 ATGTAGCAGGGGAGGCTGCAGGG + Intronic
1085948711 11:81303918-81303940 GTGGGGCAGGTGAGGGAGCTGGG + Intergenic
1086878520 11:92126913-92126935 GTGCTGGAGGTGAGCCTGATGGG + Intergenic
1088591625 11:111408381-111408403 CAGAAGCAGGTGAGGCTGCTCGG + Intronic
1088890826 11:114042913-114042935 GTGAGGCAAGTGAGGCAGCTAGG - Intergenic
1089378842 11:118013346-118013368 ATGAAGCAGGGGAGGCTCCTGGG + Intergenic
1091685328 12:2557454-2557476 GTGCAGGAAGTGAGGCTGGGAGG - Intronic
1091845361 12:3651986-3652008 GTGCAGCCGGTGAGCATGCTGGG - Intronic
1093131781 12:15400358-15400380 GTGCAGCAGGTGAGGCTGCTGGG - Intronic
1095225390 12:39672140-39672162 GTGCATCAGGGGTGGCTGATGGG + Intronic
1095417935 12:41996170-41996192 GTGGAGCAGGTAGGGATGCTGGG - Intergenic
1095533842 12:43223315-43223337 GTACAGGAGGTGAAGCTGCCTGG + Intergenic
1095550228 12:43428387-43428409 GTGCAGGAGGGCAGGCTGCCAGG + Exonic
1095941258 12:47728624-47728646 GGGAAGAGGGTGAGGCTGCTTGG + Intergenic
1096749567 12:53750219-53750241 GTTCATCAGGGAAGGCTGCTAGG + Intergenic
1101560066 12:105848551-105848573 TTGAAGGAGGTGAGCCTGCTGGG + Intergenic
1101671952 12:106883884-106883906 GGGCAGGAGGTAAGGCTGCAAGG - Intronic
1102473608 12:113174712-113174734 GTGCAGCAGGTGGAGCAGCACGG + Exonic
1103703582 12:122860042-122860064 GTGCAGGAGTTGAGGATCCTGGG - Exonic
1103859664 12:124002300-124002322 GTGCAGGAGGTGAGGTTGGAAGG + Intronic
1103885389 12:124196572-124196594 GGGCAGCTGGTGAGTCAGCTGGG + Intronic
1104080747 12:125428653-125428675 GTGCAGGAGGTGAGCTTGGTTGG - Intronic
1104676439 12:130715019-130715041 CTGCGGCAGGCCAGGCTGCTGGG - Intronic
1104845319 12:131844030-131844052 CGGCAGCAGGGGAGGCTCCTCGG - Exonic
1105304698 13:19160354-19160376 ATGCAGGAAGTGAGGCTCCTGGG - Intergenic
1105705768 13:22966602-22966624 CTACAGCAGGTCAGTCTGCTGGG + Intergenic
1105858672 13:24391587-24391609 CTACAGCAGGTCAGTCTGCTGGG + Intergenic
1106865622 13:33960753-33960775 GTGCAGGAGGCCAGTCTGCTGGG - Intronic
1106925683 13:34610571-34610593 CTGCAGCAGGTGTAGCTGCTAGG - Intergenic
1107385764 13:39907238-39907260 GAACGGCAGGTGAGGCAGCTAGG + Intergenic
1108969067 13:56349285-56349307 GTGCAGAAGGTGGGGCTCCTAGG - Intergenic
1110666704 13:78125522-78125544 GTGCAGCAGGAAAGGCTGTATGG + Intergenic
1111124446 13:83896213-83896235 GTGCAGCTGGTCTGGCTGATAGG - Intergenic
1112192301 13:97189881-97189903 GTGCAGCTGGTGACTCTGCGTGG + Intergenic
1112430031 13:99343050-99343072 GTGCAGCAGAGGTGGCTGCCAGG + Intronic
1113098216 13:106688911-106688933 GAGCAGCTGGAGAGGCGGCTGGG + Intergenic
1113707260 13:112442919-112442941 GTGGAGGAGGTGGTGCTGCTGGG - Intergenic
1113844201 13:113376516-113376538 GTGCAGCAGGAGCTGCTTCTGGG + Intergenic
1114536235 14:23424755-23424777 GTGCAGGCGGTGAGGCTCCTGGG - Exonic
1114723793 14:24911745-24911767 CTGCTGCAGATGTGGCTGCTGGG - Intronic
1116954851 14:50913015-50913037 GTGAAGCAGGTGAGCCTTCCAGG - Exonic
1119779572 14:77269296-77269318 GGGCAGCAGGTCAGGCTCCAGGG + Exonic
1120183615 14:81369832-81369854 CTTCAGCAGCTGAGGCTGTTAGG - Intronic
1121014670 14:90541338-90541360 GAGCGGCAGGTGAGGCTGGCAGG + Exonic
1121733975 14:96205301-96205323 GTGCAGCAGGGACGGGTGCTGGG + Intronic
1122193794 14:100069293-100069315 GTGAAGGAGCTGTGGCTGCTTGG + Intronic
1123439893 15:20282567-20282589 GGGAAGCTGGTGAGGCTGCCTGG - Intergenic
1123497289 15:20840983-20841005 GTGGAGCAGGTGCTGCTGCGTGG - Intronic
1123554524 15:21414622-21414644 GTGGAGCAGGTGCTGCTGCGTGG - Intronic
1123590768 15:21851936-21851958 GTGGAGCAGGTGCTGCTGCGTGG - Intergenic
1123918609 15:25055133-25055155 CTGCAGCAGGTGTGGCCGCTCGG - Intergenic
1123919501 15:25060460-25060482 CTGCAGCAGGTGGGGCCGCCTGG - Intergenic
1123920418 15:25065972-25065994 CTGCAGCAGGTGGGGCCGCCTGG - Intergenic
1123945712 15:25237901-25237923 GTGCAGGAGCTGAGGGTGCCAGG - Intergenic
1124214120 15:27792525-27792547 GTGTGGGAGGTGAGGCTGCTTGG - Intronic
1124941805 15:34225192-34225214 AGGCAGCAGGTGAGGCACCTGGG + Exonic
1125539186 15:40459888-40459910 TTGCAGCAGGTGAGGCTTCCTGG + Exonic
1125715458 15:41817450-41817472 GCGCAGAAGGTGAGGGCGCTGGG + Exonic
1126122941 15:45269685-45269707 GCGCTGCAGATGAGGCTGCTAGG - Intronic
1126356249 15:47799792-47799814 GGGCAGCAGGTGATGCTGTGGGG - Intergenic
1126804916 15:52338314-52338336 GTGAAGCTGGAGAGGCTGGTGGG + Intronic
1129164237 15:73767268-73767290 GTGCAGCAGGAGTGGGTGCTGGG + Intergenic
1129778959 15:78256625-78256647 TTGAATCAGGTGAGCCTGCTAGG - Intergenic
1131637057 15:94247274-94247296 GGGCAGCAGGTGAGGCACCCAGG - Intronic
1132107148 15:99071204-99071226 GTGGAGCAGGTGAGGAGGCGGGG + Intergenic
1132162519 15:99556252-99556274 GTGCAGCTGGTCTGGCTGATAGG + Intergenic
1132414942 15:101613093-101613115 GTGCAGGGGCTGGGGCTGCTGGG + Intergenic
1202962869 15_KI270727v1_random:141815-141837 GTGGAGCAGGTGCTGCTGCGTGG - Intergenic
1132686631 16:1164952-1164974 GTGCAGCAGGTGGGGCCCCTCGG + Intronic
1132772240 16:1570209-1570231 GGGCACCAGGTGTGCCTGCTGGG + Intronic
1133226141 16:4341354-4341376 GTCCAGAAGGTGAGGCCACTGGG - Exonic
1133424444 16:5675644-5675666 GTGCAGCCCGTGTGGCTGCTGGG + Intergenic
1133924112 16:10180531-10180553 CAGCAGCAGGATAGGCTGCTGGG + Intronic
1134261824 16:12657063-12657085 GTGAAGCAGGTGAGGCTTTCTGG - Intergenic
1134468379 16:14499222-14499244 CTGGAGCAGGTTAGGCTGCTAGG + Intronic
1135323918 16:21513923-21513945 GTGAAGCATGGGAGCCTGCTGGG - Intergenic
1136065403 16:27755081-27755103 GAGCAGGAAGTGAGGCTGCCAGG - Intronic
1136335403 16:29607191-29607213 GTGAAGCATGGGAGCCTGCTGGG - Intergenic
1136606322 16:31336521-31336543 GTGCAGCTGGTGTGGCTGCCTGG + Intergenic
1136615807 16:31397742-31397764 GTGAAGGAGGAGGGGCTGCTAGG + Intronic
1139268415 16:65660547-65660569 ATGCAGCAGGGGAGGATGCCTGG - Intergenic
1139410281 16:66753151-66753173 GACCAGCAGATGAGGCTGCTAGG + Intergenic
1140563559 16:76012459-76012481 GTGCTGCAGGTGCAGCTGCCTGG - Intergenic
1141095413 16:81159587-81159609 GTGAAGGAGATGAGGCAGCTTGG - Intergenic
1141254325 16:82386560-82386582 GTGAAGCAGGGGAGGCTGCCTGG + Intergenic
1141590732 16:85067040-85067062 GAGCTGCTGGTGAGGCTGCCTGG - Exonic
1142200286 16:88757853-88757875 CTGCTGGAGCTGAGGCTGCTGGG - Intronic
1142249507 16:88984655-88984677 TTGGAGCAGGTCAGGCTGCATGG - Intergenic
1142334390 16:89478175-89478197 GTGCTGCTGGCGAGGCAGCTGGG - Intronic
1142962185 17:3557865-3557887 GTGCTGCAGCTGTGGCTGGTGGG - Intronic
1143706013 17:8698147-8698169 ATGCATCAGGTGTGGATGCTGGG - Intergenic
1144206905 17:12985847-12985869 TAGCAGAAGGTGAGGCAGCTTGG + Intronic
1144674825 17:17155177-17155199 GTGCTGTGGGTTAGGCTGCTTGG + Intronic
1145259109 17:21344129-21344151 AGGCGGCAGGTGAGGCTGCAAGG - Intergenic
1145317509 17:21743874-21743896 AGGCGGCAGGTGAGGCTGCAAGG + Intergenic
1146695237 17:34903887-34903909 GTGCTGCAGGAGAGGCAGCGAGG + Intergenic
1146950133 17:36899962-36899984 GTGCAGGAGCTGAGGCTGACAGG + Intergenic
1147371819 17:39997695-39997717 GTGCAGGGGGTGGGGGTGCTGGG + Exonic
1148122542 17:45221638-45221660 CTGCGGCAGGTGAAGCGGCTCGG + Intronic
1149374668 17:56031985-56032007 GTGCAGGAGGTGAGGATGGTGGG + Intergenic
1151667992 17:75556520-75556542 GGGCAGGGGGTGAGGCTGCTGGG + Intronic
1151745608 17:76010157-76010179 GGTCAGCAGATGAGGCTGCATGG + Exonic
1152261636 17:79270383-79270405 GTGCAGGAGGAGAGGCTTTTAGG - Intronic
1152356262 17:79809139-79809161 GTGCACCTGGTGGGGGTGCTAGG + Intergenic
1152713231 17:81885432-81885454 GGGCAGCAGGTCAGGTAGCTGGG - Intergenic
1154427049 18:14280089-14280111 GAGCAGGAGCTGGGGCTGCTGGG - Intergenic
1155071406 18:22320148-22320170 GTGAGGCAGGTGAGCCTGTTGGG + Intergenic
1156477796 18:37417206-37417228 GTGCAGGAGATAGGGCTGCTTGG + Intronic
1157144715 18:45150126-45150148 GTGCAACAGGTAAGGCATCTTGG - Intergenic
1157198749 18:45641311-45641333 GGCCAGCAGGTGAGTCTGCCAGG - Exonic
1160060514 18:75525228-75525250 ATACAGCAGGTGAGACTGCGAGG - Intergenic
1160726581 19:620351-620373 GTCCATCAGGTGAGCCAGCTGGG - Exonic
1160831573 19:1106993-1107015 GCACAGCAGGTGGGGCTGCACGG - Intergenic
1161587063 19:5111280-5111302 GGGCATCAGGTGGGGCTGCTTGG + Intronic
1161840549 19:6677772-6677794 GAGCTGCAGGTGAGGCGGCTGGG + Exonic
1161911137 19:7195017-7195039 CTGCAGGAGGGGATGCTGCTGGG - Intronic
1162003511 19:7763291-7763313 GTGCAGCAGCTGGGCCTCCTGGG + Exonic
1162300996 19:9844945-9844967 GTGCAGGAATGGAGGCTGCTGGG - Intronic
1162992847 19:14314596-14314618 GTGCAGAAGGGGAGGCTGGGTGG + Intergenic
1163207702 19:15815649-15815671 GCTCAGCTGGTGTGGCTGCTTGG - Intergenic
1163390890 19:17029043-17029065 GTGCAGCTGGTCTGGTTGCTTGG - Intergenic
1164934479 19:32200415-32200437 CTGCAGCAGCTGAGGCTCCAGGG - Intergenic
1165144801 19:33724313-33724335 GTGCAGAAGGGGAAGGTGCTGGG + Intronic
1165243347 19:34483654-34483676 GTGGAGGCTGTGAGGCTGCTGGG - Intronic
1167785492 19:51632457-51632479 GTGCAGCAGGTGAGGGAGGCTGG - Intronic
1202638251 1_KI270706v1_random:60326-60348 GAGCAGGAGCTGCGGCTGCTGGG + Intergenic
925265469 2:2563598-2563620 GTGAAGCAAGTGAGGCAGGTGGG + Intergenic
925589016 2:5491879-5491901 GTGCAGCATGTGATGATTCTGGG - Intergenic
925883293 2:8370516-8370538 TTGCAGCAGGTGGATCTGCTGGG - Intergenic
925999598 2:9319545-9319567 GTGCTGCATGTCAGGCTGCCAGG + Intronic
926430286 2:12778598-12778620 GTGCATCAGCTGAGACTTCTGGG + Intergenic
927155496 2:20219039-20219061 GCGCAGCAGGAGAGGTCGCTGGG + Intronic
928438568 2:31272495-31272517 CTGCAGCAGGAGAGGCTTCATGG + Intergenic
930054190 2:47239506-47239528 ATGCAGCAGGCGAGGGGGCTGGG + Intergenic
932073403 2:68643214-68643236 GAGCAGCGGGGGAGGCTCCTCGG + Intergenic
932429751 2:71667241-71667263 GTGCTGGGGGTGAGGCTGCGGGG + Intronic
932621826 2:73269310-73269332 GTGCAGCAGGTGCGGCGCCGCGG + Exonic
934493692 2:94779775-94779797 GAGCAGGAGCTGGGGCTGCTGGG + Intergenic
934704104 2:96464309-96464331 GTGTAGCAGCTGAGGCCGCCAGG + Intergenic
935442989 2:103123532-103123554 GGGCAGCAGCTGAGGCACCTGGG - Intergenic
935568460 2:104634554-104634576 GTGCAGCAGGTCAAGATGCTGGG - Intergenic
936271212 2:111050651-111050673 TTGCAGGAGGTGAAGCTCCTGGG + Intronic
936410658 2:112255100-112255122 GCGGGGCAGGTGAGGCTGCGCGG - Exonic
936711801 2:115140348-115140370 AGGCAGCAAGTGAGGCTGCAGGG + Intronic
938132727 2:128731495-128731517 GTGAAGAAGGTGAGGCTGACAGG + Intergenic
938293497 2:130162639-130162661 ATGCAGGAAGTGAGGCTCCTGGG - Intronic
938463056 2:131510322-131510344 ATGCAGGAAGTGAGGCTCCTGGG + Intergenic
942494125 2:176521110-176521132 GTTCAGGAGTTGAGGCTCCTTGG + Intergenic
942543413 2:177038068-177038090 GAGCAGCAGGAAAGGCTTCTTGG + Intergenic
944645454 2:201775687-201775709 GTGCAGCAGTTAAGGCTGAGAGG - Intronic
945975045 2:216263910-216263932 GTGCAGAGAGTGAGGCTGCCAGG + Intronic
946748101 2:222865611-222865633 GTGCAGCAGTGGAATCTGCTAGG + Intronic
946955686 2:224927820-224927842 GTGCTGCAAGTGTGGGTGCTTGG + Intronic
948142599 2:235684978-235685000 GTGCTCCAGGTGTGGCTGGTTGG + Intronic
948338440 2:237229956-237229978 GTCCAGCACCTGAAGCTGCTGGG - Intergenic
948794641 2:240396055-240396077 GTGCAGCAGCTGAGGATCCCGGG - Intergenic
948820126 2:240538551-240538573 GTGCAGGAGGTGGGGGCGCTCGG - Intronic
948932345 2:241140093-241140115 GGGCAGCTGGTGGAGCTGCTGGG - Intronic
1169403047 20:5299949-5299971 GGGCTGAAGGTGAGTCTGCTGGG + Intergenic
1170377057 20:15711582-15711604 CTGCAGCAGGTGCTGCAGCTTGG + Intronic
1170782658 20:19439216-19439238 GTGGAGCATGGGATGCTGCTGGG + Intronic
1170809157 20:19660057-19660079 GTGCAGGAGGGGAGGGTGATGGG - Intronic
1170866271 20:20160811-20160833 TTGCAGCAGGGCAGGCTGTTTGG + Intronic
1170899982 20:20453258-20453280 GACCAGGAGGTGAAGCTGCTTGG - Intronic
1171108072 20:22455181-22455203 GTGGACCAGGAGAGGCTGTTGGG - Intergenic
1171485229 20:25481231-25481253 GGGGAGCAGGTGGGGCTGCTGGG + Intronic
1171884840 20:30644389-30644411 GAGCAGGAGATGGGGCTGCTGGG + Intergenic
1172441933 20:34971941-34971963 CTGCAGCTGGTGGGGCTGCTTGG + Intergenic
1172534570 20:35663765-35663787 GTGCAGCAGGCTTAGCTGCTAGG - Intronic
1173255574 20:41392355-41392377 GTGCAGCAGGAGAGGGTGCTGGG + Intergenic
1173619800 20:44428368-44428390 CTGCATCAGGTGAGGGTGCAGGG - Exonic
1173723366 20:45279386-45279408 GTGCAGCTGGTGGGCCAGCTAGG - Intergenic
1173912212 20:46678801-46678823 GTGTAGGAGGTGGGGCTGGTGGG + Intronic
1174151562 20:48489695-48489717 GTGGAGAAGGCGAGGCTGATGGG + Intergenic
1174172833 20:48627847-48627869 CGGAAGCAGGTGAGGCCGCTTGG - Exonic
1175396710 20:58669351-58669373 GAGCAGGAGGGGCGGCTGCTTGG + Exonic
1175929134 20:62485360-62485382 CTGCAGCAGCTGTGGCTGCTCGG - Intergenic
1176045590 20:63091065-63091087 GTGAGCCAGGTGAGGCTTCTTGG + Intergenic
1176047547 20:63100684-63100706 ATGCAGGAGGGGAGGCTGCAGGG - Intergenic
1176082905 20:63282913-63282935 GTGCAGCACCTGAAGCTGCCTGG + Intronic
1176092681 20:63325962-63325984 GTGAGGCAGCTGAGGCTGCCAGG - Intronic
1176120377 20:63451864-63451886 GTGCAGCAGAGGCCGCTGCTGGG - Intronic
1178632387 21:34273840-34273862 GTGCAGGAGGTAAGTCTGGTTGG - Intergenic
1179578071 21:42320114-42320136 GTAGAGCAGGTCTGGCTGCTGGG - Intergenic
1179835391 21:44028526-44028548 GTGCGGCAGGTCAGGAAGCTGGG - Intronic
1179939416 21:44628326-44628348 GGGCAGAGGGTGACGCTGCTGGG - Intronic
1180108638 21:45637239-45637261 GTGCAGCAGTGGAGCCTGCTGGG + Intergenic
1180363715 22:11921553-11921575 GAGCAGGAGCTGTGGCTGCTGGG - Intergenic
1180961163 22:19763023-19763045 GCGCAGCAGGGGAGCCTCCTGGG - Intronic
1182428569 22:30287466-30287488 GTGCGGCAGTGCAGGCTGCTGGG - Exonic
1183217652 22:36491349-36491371 ATGCTGGAGGTGGGGCTGCTGGG + Intronic
1183650801 22:39152362-39152384 GTGCGGAAGGTGAGGCTGCCCGG - Exonic
1183726443 22:39592552-39592574 GTGAAGTAGGCGAGGCAGCTGGG + Intronic
1184238598 22:43199862-43199884 GGGCAGCAGGTGAGGCCACCTGG + Exonic
1184286299 22:43473631-43473653 GCCCAGCAGCTGAGGCTGGTGGG + Intronic
1184696391 22:46141474-46141496 GGGAAGCTGGTGAGGCTGCCTGG - Intergenic
950008468 3:9705712-9705734 CTGCAGAAGGTGAGGCTGAATGG + Exonic
950228530 3:11255990-11256012 GGGCAGAAGGTGAAGCTGCAAGG + Intronic
950965039 3:17140155-17140177 CTGCAGAAGGTGAGGATGCTGGG + Intergenic
952945622 3:38476516-38476538 GAGCACCAGGTGTGGTTGCTGGG + Intronic
953018294 3:39098476-39098498 GTGTTGCAGGTGAGGCTACATGG - Exonic
954211383 3:49099492-49099514 GTGCGGTAGGTGCGGCTGTTTGG - Exonic
954333636 3:49903833-49903855 GGGCGGCAGGTGAGGCGGCTGGG - Intronic
954334672 3:49909347-49909369 GAGGAGCAGGAGCGGCTGCTGGG - Exonic
954427904 3:50453284-50453306 GTACAGATGGAGAGGCTGCTAGG - Intronic
954637724 3:52080382-52080404 GGACAGCAGGTGCTGCTGCTGGG - Intronic
954899041 3:54003351-54003373 GGGCAGCAGATGAAGCAGCTTGG - Intergenic
955640746 3:61081274-61081296 GGGCAGCAGGAGAGGCAGGTTGG - Intronic
958830999 3:99089031-99089053 GAGCAGGATGTGAGGGTGCTGGG + Intergenic
961469581 3:127102891-127102913 CTGCAGCAAGAGAGGCTTCTGGG - Intergenic
962412940 3:135157184-135157206 CTGCAGCAGGTGGTGGTGCTGGG + Intronic
963228701 3:142888741-142888763 AAGCAGCAGGCGAGGCTGCAGGG + Intronic
963334858 3:143963143-143963165 GTGCTGGAGGTGAGCCTGATGGG - Intergenic
963419383 3:145040788-145040810 GAGAAGAAGGTGAGGCTGCTGGG + Intergenic
965220142 3:165918402-165918424 GTGCTGCAGGTGGAGCTGCCTGG + Intergenic
968503046 4:960072-960094 GGGCAGCGTGTGAGGCTGCCGGG - Exonic
968522073 4:1038532-1038554 TGGGAGCAGGTGGGGCTGCTGGG - Intergenic
968732125 4:2274143-2274165 GGGCAGCATGCGTGGCTGCTGGG + Exonic
968881183 4:3301013-3301035 GGGCAGCCGGGGAGGCTCCTGGG - Intronic
969871704 4:10108797-10108819 GAGCATCAGGGAAGGCTGCTTGG - Intronic
969963721 4:10973223-10973245 GTGAAGCAGGTGAGGCTCTCGGG - Intergenic
971265317 4:25091672-25091694 TAGCAGCTGGTGAGGCAGCTGGG + Intergenic
972374155 4:38455233-38455255 TAGCAGCATGTTAGGCTGCTGGG - Intergenic
974629005 4:64458564-64458586 GTTCAGCAGGGCAGGCAGCTAGG - Intergenic
975487817 4:74953831-74953853 GGGAAGCAGGTGAGCCAGCTTGG + Intronic
977032910 4:91909631-91909653 CTCCAGAAGGTGAGTCTGCTTGG - Intergenic
980000872 4:127486237-127486259 CTGCAGAGGGTGAGGGTGCTTGG + Intergenic
981809155 4:148753823-148753845 CTGCAGCAGATGAGGCTGTATGG + Intergenic
983154716 4:164332503-164332525 GTGGAGCAGGGGAAGATGCTGGG + Intronic
984695489 4:182775313-182775335 GTGCAGCTGGGGAGGCTGGAGGG + Intronic
984797058 4:183671453-183671475 GAGCAGCAGTTGGGGCTGCGGGG - Intronic
985067255 4:186134720-186134742 CTGCAGCACACGAGGCTGCTAGG - Intronic
1202765590 4_GL000008v2_random:146184-146206 GAGCAGGAGCTGCGGCTGCTGGG + Intergenic
985609787 5:880989-881011 GGGCAGCATGAGAGGCTGCCCGG - Intronic
985629536 5:1007526-1007548 AGCCAGCAGGGGAGGCTGCTGGG + Intergenic
985741480 5:1619734-1619756 GTGCAGCTGGAGACTCTGCTGGG - Intergenic
986583609 5:9291706-9291728 TGGCATCAGATGAGGCTGCTTGG - Intronic
988693816 5:33598910-33598932 ATGCAGCAGATGAAGTTGCTTGG - Intronic
989552352 5:42750647-42750669 GAGCAGCAGGTGAGGAAGCGAGG + Intergenic
990937112 5:61162640-61162662 GAGCGGCAGGTGAGGCCGCGCGG + Intergenic
993841903 5:92890393-92890415 GTGGAGCAGAAGAAGCTGCTTGG - Intergenic
997727491 5:136133374-136133396 GTGCAGCAGCCCAGGCTGCCCGG - Intronic
997738099 5:136229234-136229256 GGGCAGCAGCTGAGGCTTCATGG + Intronic
1002105636 5:176878250-176878272 GTGCAGCTGGAGAAGCAGCTGGG + Exonic
1002327045 5:178416445-178416467 GTGCTGCTGGTCTGGCTGCTGGG + Intronic
1002368476 5:178730718-178730740 GGGCAGCCGCTGAGGCCGCTGGG + Intergenic
1002897670 6:1389123-1389145 CTGCTGCGGGTGCGGCTGCTCGG - Intergenic
1004800474 6:19141271-19141293 GTGCAGCAGCTGAGACTCCTTGG - Intergenic
1004909859 6:20272540-20272562 GAGCAGCAGCTTAAGCTGCTCGG + Intergenic
1005942444 6:30570978-30571000 GCCCATCAGGTGAGGCTGGTAGG - Intergenic
1005942548 6:30571552-30571574 GCCCATCAGGTGAGGCTGGTAGG + Exonic
1006297180 6:33174909-33174931 GTGAAGCAGGAGTGGGTGCTGGG - Intronic
1006391512 6:33761612-33761634 GTGCACCAGGGCAGGCTGCAGGG + Intergenic
1007352255 6:41282423-41282445 GAACAGCATGTGAGGCTCCTTGG + Exonic
1008364035 6:50654937-50654959 GTGTTGCAGGTGAGGCTGACTGG + Intergenic
1008613358 6:53204353-53204375 GGGCTGCAGGTGAGGCTGACTGG + Intergenic
1008689404 6:53960666-53960688 ATGCAACATGTGAGGCTTCTGGG + Intronic
1011130274 6:84045296-84045318 GTACAGCTGATGAGGCTGCGAGG + Intronic
1012493254 6:99806587-99806609 GTGCTGCTGCTGAGACTGCTTGG - Intergenic
1013133878 6:107261254-107261276 ATGCAGGAGGTGGGGCTGGTGGG + Intronic
1014540635 6:122671424-122671446 GGGGATCAGGTGAGGTTGCTTGG - Intronic
1015226414 6:130862017-130862039 CAGCAGCAGTTAAGGCTGCTGGG + Intronic
1015542091 6:134325033-134325055 TAGCAGCATGTGAGGCTCCTGGG - Intergenic
1016878302 6:148885313-148885335 GTGCAGCTGGTGCGGCTGCCTGG - Intronic
1018827324 6:167419122-167419144 AAGCAACAGGTGAAGCTGCTGGG + Intergenic
1019461186 7:1159825-1159847 TTGCTGGAGGTCAGGCTGCTGGG - Intronic
1019616396 7:1964864-1964886 GTGCCGCAGGTGAGGCTCCTGGG + Intronic
1019779207 7:2929758-2929780 CTGCAGCAGGAGAGGGTGTTGGG + Intronic
1020110142 7:5443316-5443338 GGGCAGCTGGTGTGGGTGCTGGG - Intronic
1022434764 7:30372344-30372366 GTGCAGCAGATGATGCTTCGAGG + Intronic
1022505351 7:30906036-30906058 GAGCAGGATGGGAGGCTGCTGGG + Intergenic
1023884878 7:44347648-44347670 AAGCAGGAGGTGAGGCTGCAAGG - Intergenic
1023889616 7:44382842-44382864 GTGCAGCAGCTGACGCCTCTTGG + Exonic
1023902184 7:44490395-44490417 GTGCTGCAGGTGAGGCGGGCGGG - Exonic
1024083582 7:45875714-45875736 GTGAAGCAGCGGGGGCTGCTTGG + Intergenic
1024962602 7:54993424-54993446 TTTCAGTAGGGGAGGCTGCTTGG + Intergenic
1026233370 7:68505022-68505044 CTGCAGGAGCTGAGGCTGCCAGG + Intergenic
1026504382 7:70969799-70969821 GAGCAGGAGGTGTGGTTGCTGGG + Intergenic
1027126437 7:75559835-75559857 CTGCCGCAGGTGCTGCTGCTCGG + Exonic
1029711288 7:102301331-102301353 GGGCAGCAGCTGAGGGTGCCAGG + Intronic
1031073578 7:117190365-117190387 CAGCAGCAGGCGAGCCTGCTTGG - Intronic
1031351854 7:120742562-120742584 GTGAAGCAGGTGGTGGTGCTGGG - Exonic
1031521408 7:122770807-122770829 GTGCAGCAGGAGCTGCTGCAGGG + Intronic
1031836224 7:126684997-126685019 TAGCAGCAGGAGAGGCTGCAGGG + Intronic
1031843499 7:126775870-126775892 GTGCAGCAGATGAAGCTGGAGGG - Intronic
1033781808 7:144680139-144680161 GTGTGGCAGGTGAGGCTGTTGGG - Intronic
1034943379 7:155246572-155246594 GGGGAGCAGGTGGGGCTGCGTGG + Intergenic
1035761947 8:2074954-2074976 GGGCAGCAGGTAAGGATGCCCGG - Intronic
1036201597 8:6775180-6775202 GTGGGGCAGGAGAGGCCGCTTGG + Intergenic
1036686503 8:10914957-10914979 GTGCAGGAGGGGAGGCGGCCAGG - Intronic
1037813363 8:22099336-22099358 GTGCAGGAGCTGGGGCTGCAGGG - Exonic
1038424525 8:27455898-27455920 GTGCCGCAGGGCTGGCTGCTGGG - Intronic
1039472470 8:37821913-37821935 GGGCCGAGGGTGAGGCTGCTGGG + Intronic
1040307454 8:46219556-46219578 GGACAGCAGGGGAGGATGCTGGG + Intergenic
1045290485 8:100828449-100828471 GTGCAGCAAGTGGGACTTCTGGG - Intergenic
1045368985 8:101502374-101502396 GTGAAGGAGGTGAGGGGGCTTGG - Intronic
1045390012 8:101705785-101705807 CTGGAGCAGCTGAGGCTTCTTGG - Intronic
1045550024 8:103163302-103163324 CAGCAGCAGGTGAGTCTTCTGGG - Intronic
1047511508 8:125519636-125519658 GGGAAGCAGATGAGGCAGCTAGG - Intergenic
1048292154 8:133189503-133189525 CTGAAGCATGTGTGGCTGCTTGG - Intergenic
1049055233 8:140231179-140231201 GGGCAGCACCTGAGGCTGCGAGG - Intronic
1049651970 8:143773917-143773939 GGGCAGCAGCTGGGGGTGCTGGG + Intergenic
1049790112 8:144468542-144468564 GTGCAGGAGGTGCAGCTGCAGGG + Exonic
1053663393 9:40300257-40300279 GAGCAGGAGCTGGGGCTGCTGGG - Intronic
1053664860 9:40310356-40310378 GAGCAGGAGCTGGGGCTGCTGGG - Intronic
1053913904 9:42930798-42930820 GAGCAGGAGCTGGGGCTGCTGGG - Intergenic
1054375516 9:64446491-64446513 GAGCAGGAGCTGGGGCTGCTGGG - Intergenic
1054521221 9:66076028-66076050 GAGCAGGAGCTGGGGCTGCTGGG + Intergenic
1054755299 9:68951462-68951484 AAGCAGCAGGTGAGGGTGGTTGG - Intronic
1056143524 9:83707486-83707508 GTCCAGCAGGTGAGGCCGCCTGG - Exonic
1056455729 9:86757573-86757595 ATGCAGCAGCTGAGGCTGTTTGG - Intergenic
1056514108 9:87333731-87333753 GTGTAGCAGGTGAAGCAGCAGGG - Intergenic
1057317611 9:93979804-93979826 GTGCCGCAGGGGAGGCAGCTAGG - Intergenic
1057422633 9:94924865-94924887 GTGCACCAGGTCTGGCTTCTGGG - Intronic
1057911855 9:99025797-99025819 GGGAGGCAGGTGAGGCTGGTGGG - Intronic
1058851101 9:109013059-109013081 CGGCAGCAGGGGAGGCTGCGGGG - Intronic
1059782005 9:117539560-117539582 GTACAGGAGGTGTGGATGCTTGG - Intergenic
1060205435 9:121680163-121680185 GTGTAGGAGGTGAGGCTGGGAGG + Intronic
1060444996 9:123679741-123679763 AGGCTGCAGGTGAGGCTGCAGGG + Intronic
1060827619 9:126695760-126695782 GATCAGAAGGGGAGGCTGCTGGG + Intronic
1060933621 9:127503789-127503811 GTGAGGCAGCTGAGGCTGATGGG + Intergenic
1061356597 9:130110240-130110262 GCACAGCAGGTGAGGCAGCATGG + Intronic
1061760343 9:132846907-132846929 GTGAAGCTGGAGAAGCTGCTGGG + Intronic
1061779822 9:132989028-132989050 GGGCAGCATGTGAGGCCACTGGG - Intronic
1061993659 9:134173454-134173476 GGGCTGCTGGTGAGGCTGCGGGG + Intergenic
1062277309 9:135737010-135737032 GGGCTGCAGGTGAGACTGCAGGG + Intronic
1062285901 9:135772362-135772384 GTGCAGCTGGTCAGGCTGCCTGG - Intronic
1062328555 9:136024851-136024873 GTGGAGCAGCTGAGGCGGCAGGG + Intronic
1062423711 9:136496596-136496618 CTGCACCAGGTGAGGCTGGGTGG + Exonic
1062607247 9:137353777-137353799 GTGCAGGAGCTCAGCCTGCTGGG - Intronic
1203546336 Un_KI270743v1:131074-131096 GAGCAGGAGCTGCGGCTGCTGGG + Intergenic
1188164277 X:26842878-26842900 GTGCAGCAGGGTTGGCAGCTGGG - Intergenic
1192210018 X:69121917-69121939 GTGCATCAGGTGAGTCGGCTGGG - Intergenic
1196034388 X:111128083-111128105 AAGAAGCAGGTGAGGCTGCGAGG + Intronic
1196473718 X:116058616-116058638 AAGCAGCTGGTGGGGCTGCTGGG + Intergenic
1197240099 X:124114377-124114399 GTCCAGAATCTGAGGCTGCTCGG + Intronic
1199852992 X:151738585-151738607 AAGCAGCAGGTGAGTCTGCATGG + Exonic