ID: 1093135315

View in Genome Browser
Species Human (GRCh38)
Location 12:15442691-15442713
Sequence CACCAATAGCATTCAAGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 6, 2: 14, 3: 48, 4: 146}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093135315 Original CRISPR CACCAATAGCATTCAAGCTG AGG Intronic
906758478 1:48346664-48346686 CACCAACAATAGTCAAGCTGAGG + Intronic
910447932 1:87317754-87317776 CAAGAATAGCATCAAAGCTGAGG - Intergenic
913573870 1:120149677-120149699 CACCAATAGCATTCAATCTGAGG - Intergenic
914295128 1:146314477-146314499 CACCAATAGCATTCAATCTGAGG - Intergenic
914383334 1:147141146-147141168 CACCAATAACATCCAAGCTGAGG + Intergenic
914556169 1:148765260-148765282 CACCAATAGCATTCAATCTGAGG - Intergenic
914616664 1:149364973-149364995 CACCAATAGCATTCAATCTGAGG + Intergenic
915695476 1:157737341-157737363 TACCAATAACAATCAAGCTGAGG - Intergenic
919306355 1:195844103-195844125 CACCAACAGCAACCAAGCTGAGG - Intergenic
919398001 1:197074297-197074319 CACCAACAGCAACCAAGCTGAGG + Intergenic
919453201 1:197795035-197795057 CACTAATAACATCCAAGCTGAGG - Intergenic
920307914 1:205030880-205030902 CACTAATAGGATGAAAGCTGGGG - Intergenic
920731718 1:208492726-208492748 CACCAGTAACATTCAAACTGAGG - Intergenic
920858257 1:209682059-209682081 TACCAAAAGCATTCAAGCAGGGG + Intergenic
923857703 1:237862768-237862790 CACAAATAGAGTTAAAGCTGTGG - Intergenic
924699153 1:246433165-246433187 CCCCTATAACATTCAAGCTGAGG + Intronic
1063850674 10:10186257-10186279 CACCACTGGCATTCCAGCTTGGG + Intergenic
1066314545 10:34230982-34231004 CACCACTAGCATTCCAGCCTGGG + Intronic
1067138717 10:43635882-43635904 CACCAACAACAGTCAAGCTGAGG - Intergenic
1068218678 10:54015109-54015131 TACCAACAACATCCAAGCTGAGG + Intronic
1068925707 10:62535482-62535504 CACCAATAACATACAAGCTGAGG + Intronic
1073999193 10:109351489-109351511 CACCATTAACGTTCAAGCTAAGG - Intergenic
1076260723 10:129063356-129063378 CTCCAATAGCACACTAGCTGGGG + Intergenic
1077722834 11:4644937-4644959 CCCCAATATCATTCTTGCTGGGG + Intronic
1079958276 11:26890553-26890575 CACCAATAACATCCAAGCTCAGG + Intergenic
1084137001 11:67191750-67191772 CACCAAAAGCATTTAAGATCAGG + Intronic
1085015853 11:73173688-73173710 CCCTAAGTGCATTCAAGCTGGGG + Intergenic
1086384952 11:86297604-86297626 CACCAATACCATTCAATGGGGGG - Intergenic
1088176302 11:107056227-107056249 CACCAACAGCAGTTAAGCTGAGG + Intergenic
1088655114 11:111991672-111991694 AACCAAGAGGGTTCAAGCTGAGG + Intronic
1089415037 11:118281472-118281494 CATCAATAGCTTTCAAGGAGTGG - Intergenic
1089885033 11:121812428-121812450 CACCAACAGTATTCACGCTAAGG - Intergenic
1093135315 12:15442691-15442713 CACCAATAGCATTCAAGCTGAGG + Intronic
1095144121 12:38703792-38703814 TACCAATAATGTTCAAGCTGAGG + Intronic
1099665956 12:85629762-85629784 CAGCAAAAACATCCAAGCTGGGG + Intergenic
1101432360 12:104637260-104637282 CACCAACAGCATTCCAGCCTGGG + Intronic
1103504923 12:121435935-121435957 AAGCATCAGCATTCAAGCTGAGG + Intronic
1105649742 13:22362960-22362982 CACCAACAACAGTCAAGCTGAGG + Intergenic
1111759318 13:92441533-92441555 CACTAATAACATTGAACCTGAGG + Intronic
1111956077 13:94759764-94759786 CATCAAAAACATCCAAGCTGAGG - Intergenic
1112104079 13:96221386-96221408 CAGCTATAGAATTCAAGCTAGGG + Intronic
1115077416 14:29408581-29408603 CACCAATAAAATCCCAGCTGAGG + Intergenic
1115311697 14:31984866-31984888 CACCCACAGAATTCAAGCAGGGG + Intergenic
1118724691 14:68620774-68620796 GACCAATTGTATTCAGGCTGTGG - Intronic
1119725240 14:76918334-76918356 CAGCAATAGCATTCATGGAGGGG - Intergenic
1120168420 14:81224800-81224822 CACCAATATCATCAAAGCTGGGG + Intergenic
1120267246 14:82266569-82266591 CACCAATTTCATTAAAGCTATGG - Intergenic
1120872788 14:89352945-89352967 CACCATTTGCACTCCAGCTGGGG + Intronic
1124494781 15:30179733-30179755 CATCGGGAGCATTCAAGCTGAGG + Intergenic
1124748788 15:32358912-32358934 CATCGGGAGCATTCAAGCTGAGG - Intergenic
1125408511 15:39380295-39380317 CACCAATAAGGTCCAAGCTGAGG + Intergenic
1126533813 15:49738987-49739009 CACCAATAAATTTCAAGCTGAGG + Intergenic
1126642686 15:50843657-50843679 CACCAACAACAACCAAGCTGAGG + Intergenic
1127358018 15:58220076-58220098 CATCAATAACATTCAAGTTGAGG - Intronic
1129194931 15:73958205-73958227 CACCAATCCTTTTCAAGCTGCGG - Intergenic
1130629133 15:85547964-85547986 CACCAAGAGCCTGCAAACTGGGG - Intronic
1131625412 15:94114028-94114050 CACCAATAACAATCTAGTTGAGG + Intergenic
1133843482 16:9431404-9431426 CACCAATAACAAACTAGCTGAGG - Intergenic
1136663463 16:31786446-31786468 CACCAATAGTGATCTAGCTGAGG - Intronic
1138755033 16:59473993-59474015 CACCAATAATAATCAAGCTGAGG + Intergenic
1139202681 16:64994908-64994930 CATCAATAACACTCAAGCTGAGG + Intronic
1139401166 16:66682756-66682778 CACAACTGGCATTGAAGCTGAGG - Intronic
1139636268 16:68260310-68260332 CACCAGGAGCATTCAAGCTCTGG + Exonic
1140317232 16:73910856-73910878 AACCAGTAGCATTCATGCTATGG + Intergenic
1141258750 16:82431037-82431059 CACCAGTAACATTCAAGGTGAGG + Intergenic
1143287949 17:5805263-5805285 CTCCAATACCATTCCAGCAGTGG + Intronic
1144158449 17:12532909-12532931 CACCAATAGCATTGCTGCTGTGG + Intergenic
1147606546 17:41776962-41776984 CACCAATTGCATTCCAGCCAGGG + Intronic
1149062624 17:52441110-52441132 CACCAATGACATCCAAGCTGAGG + Intergenic
1150032849 17:61758370-61758392 CACTATTAGAATTCAGGCTGAGG + Intronic
1156427338 18:37028327-37028349 CACCAACAACATCCAAGCTGAGG - Intronic
1160367881 18:78344236-78344258 CTCCAATTGAATTCAAGTTGGGG - Intergenic
1163988858 19:20979379-20979401 CACCAATATTATTGAAGCTGAGG - Intergenic
1164277415 19:23733168-23733190 CACCAATAACATTCAAGCTGAGG - Intergenic
1168345180 19:55647214-55647236 CACCAGAAGCATCCAAGCTCTGG - Intronic
925960017 2:9004852-9004874 TACCAAAAGTATTAAAGCTGTGG - Intergenic
926479497 2:13373672-13373694 CACAAATGTCTTTCAAGCTGAGG - Intergenic
926908300 2:17826304-17826326 CTTGAATAGCCTTCAAGCTGGGG + Intergenic
928442877 2:31307337-31307359 CACCAACAGAAACCAAGCTGAGG - Intergenic
936293735 2:111248942-111248964 CACCAACACTATTCCAGCTGGGG - Intergenic
936617402 2:114061979-114062001 CAAAAATAGCATTTAAGCAGAGG - Intergenic
937236068 2:120432553-120432575 CACCAATAGCAAACATGTTGGGG + Intergenic
937674243 2:124571917-124571939 AACCAATAAAATTCAACCTGAGG + Intronic
938823163 2:134978752-134978774 CACCATCAGCATCCAAGCTCTGG + Intronic
939947956 2:148433157-148433179 CACCAACAACATCAAAGCTGAGG - Intronic
941216538 2:162716746-162716768 GACCAATATGATTCAAACTGTGG + Intronic
943057316 2:182998507-182998529 CACTAATAACATTCAAGCTGAGG + Intronic
943082312 2:183269875-183269897 CACCAATAATATTCAAGCTGAGG - Intergenic
944438729 2:199720053-199720075 CACCAATAACAGTCTAGCTGAGG - Intergenic
945359822 2:208883900-208883922 CATCAATAACAGTCAAGCTGAGG + Intergenic
945853607 2:215040489-215040511 CACCAATAGCATGGAAGGTTTGG - Intronic
948762396 2:240200011-240200033 CACTAATAGAATTCAAGCAATGG + Intergenic
1168893964 20:1311147-1311169 CACCGCTGGCCTTCAAGCTGAGG - Intronic
1169619897 20:7493708-7493730 CATCAATAACACTTAAGCTGAGG + Intergenic
1170070833 20:12364848-12364870 CAACAATAACATTCAAGCTGAGG + Intergenic
1172149983 20:32783546-32783568 CACCAAGAGAATGGAAGCTGAGG - Intronic
1175002395 20:55643296-55643318 CCCAAATAGCATTCGTGCTGAGG + Intergenic
1175664910 20:60850334-60850356 CAACAATAGCATTTTAGCTGAGG - Intergenic
1177984850 21:27961736-27961758 CACCAAAAACAGCCAAGCTGAGG - Intergenic
1178181085 21:30162307-30162329 CTCCCATGGCATTCCAGCTGCGG + Intergenic
1182301271 22:29338574-29338596 CACCAATTGCATTTAAGGAGAGG + Intronic
949592551 3:5509483-5509505 CTCCAACAGCATTCCAGGTGAGG - Intergenic
952991721 3:38836419-38836441 CACCACCAGCATTTAATCTGTGG + Intergenic
955567808 3:60268237-60268259 CTCCTATAGCATTTAGGCTGAGG + Intronic
955923852 3:63986443-63986465 CACCGGGAACATTCAAGCTGAGG + Intronic
956590521 3:70909480-70909502 CAGAAATAGCATTCAGGCAGAGG - Intergenic
957721265 3:84002846-84002868 CACCAAGAGTAACCAAGCTGAGG - Intergenic
957759316 3:84533935-84533957 CACCAAAAACATCGAAGCTGAGG + Intergenic
959323911 3:104911774-104911796 CAATAACAACATTCAAGCTGAGG - Intergenic
962186950 3:133270259-133270281 CACCACTAGAATGCAAGCTGAGG + Intronic
963728988 3:148952629-148952651 TACCAAAAGCCTTCAAACTGTGG - Intergenic
964132979 3:153312032-153312054 CACTAATATCATTCAAACAGAGG - Intergenic
964355295 3:155846267-155846289 CAGAAATGGCATTCAAACTGCGG + Intronic
965172915 3:165291322-165291344 TGCCAATAACATTCAAGCTGAGG - Intergenic
965871701 3:173272960-173272982 CACCAATAATAATCTAGCTGAGG - Intergenic
966517653 3:180836517-180836539 CGCCAATAACATTCAAGCTGAGG + Intronic
966937138 3:184718152-184718174 AACCAAAATCTTTCAAGCTGTGG + Intergenic
969908574 4:10421391-10421413 CACCAGTAACATCCAAGCTGAGG - Intergenic
970823244 4:20244182-20244204 CACCAATAGAAATCAAGCAGGGG - Intergenic
971107692 4:23544723-23544745 CACCAACAACAGTCAAGCTGAGG + Intergenic
972123968 4:35740681-35740703 CGCCACTTGCATGCAAGCTGAGG - Intergenic
972177932 4:36430299-36430321 CACAAACAACATCCAAGCTGAGG + Intergenic
975025410 4:69542557-69542579 CACCAATAGCAGACAAACAGAGG + Intergenic
975810037 4:78158234-78158256 TAGAAATAGCATTCAATCTGTGG + Intronic
976457988 4:85272022-85272044 CACCAATAATGTTCAAGCTGAGG + Intergenic
977358188 4:95972519-95972541 GACAAATGGCATTTAAGCTGAGG - Intergenic
978263418 4:106791722-106791744 ATACAATAGCATTCAATCTGAGG - Intergenic
979150418 4:117307206-117307228 CATCAATAATATTCAAGCTGAGG - Intergenic
979497553 4:121400750-121400772 CAACACAAGCATTCAGGCTGTGG + Intergenic
980837153 4:138209586-138209608 CACTGATAACATTCAAGCTGAGG + Intronic
982299327 4:153863232-153863254 CACCAAAAGCAATCAATCAGGGG - Intergenic
983854557 4:172626786-172626808 CAACAATAATGTTCAAGCTGAGG - Intronic
983892991 4:173050036-173050058 AACCAATAGCTTTCAAAATGTGG - Intergenic
984837303 4:184033822-184033844 CACCAAAAGGATCCAAGCCGGGG - Intergenic
985301162 4:188491156-188491178 CACCAACAGCATCCAGGCTGAGG - Intergenic
988193928 5:27976288-27976310 CACCAACAACATCCAAGCTGAGG - Intergenic
988424009 5:31041340-31041362 TACCAACAGCAACCAAGCTGAGG + Intergenic
988491746 5:31711083-31711105 AAGCCTTAGCATTCAAGCTGGGG + Intronic
989784313 5:45309158-45309180 CACCAACAACAGTCAAGCTGAGG - Intronic
990167768 5:53013896-53013918 CACCAATAACGTCCAAGCTGAGG - Intronic
990289708 5:54336442-54336464 CCCCAATAGAATAAAAGCTGGGG + Intergenic
990535169 5:56714597-56714619 CAGCAATAGCATTCAAAATTTGG - Intergenic
991121402 5:63019112-63019134 CACCAACAACATCTAAGCTGAGG - Intergenic
991579788 5:68142635-68142657 CACCAATAACACTCAAGCTGAGG + Intergenic
991623315 5:68569575-68569597 CACCAAGAGCAATCAAGCTGAGG + Intergenic
992488610 5:77219493-77219515 CACAAATAGCATTAAAGCTCCGG + Intronic
993009396 5:82462833-82462855 CACCAATATCATTCAAACTGAGG + Intergenic
994934870 5:106241772-106241794 CACCAATATCCTTGAAACTGTGG + Intergenic
996632164 5:125646559-125646581 CACCAACAACAATCAAGCAGAGG + Intergenic
998291416 5:140918186-140918208 CACCAACAACATCCAAGCTGAGG - Intronic
998321817 5:141239892-141239914 CACCAACAGCATTCAGGGTCCGG - Intergenic
999641514 5:153677857-153677879 CCCCAAGAGCAATAAAGCTGAGG - Intronic
1001376901 5:171268447-171268469 CACCATTGGTATTCAAGGTGAGG + Intronic
1002582719 5:180219374-180219396 CACCAATAACATCCAAGCTGAGG - Intergenic
1005374913 6:25172491-25172513 CACCAAAAGCATTCTTCCTGAGG + Intergenic
1005604662 6:27464347-27464369 CAACAATAGCATAAAAACTGTGG + Intronic
1005611261 6:27527179-27527201 CACTCATACCACTCAAGCTGGGG + Intergenic
1005781092 6:29193052-29193074 CATCAACAACATTCAATCTGAGG + Intergenic
1008194604 6:48502981-48503003 CGGCAATAGCATTCAAGATTAGG + Intergenic
1009702945 6:67207021-67207043 CACCAATAACATTCAAGCTGAGG + Intergenic
1010851817 6:80785883-80785905 TATCAATAGCATTAAACCTGGGG - Intergenic
1012722927 6:102770363-102770385 CACCAAAAACATTCAAACTGAGG - Intergenic
1012855920 6:104501560-104501582 CTCCAAGGGCATTCAAGCTTTGG + Intergenic
1013552005 6:111217094-111217116 CTCCAATAGCAGTCAGGCTAGGG - Intronic
1013991708 6:116261410-116261432 CACCAAAAACAGTCAAGCTGAGG - Intronic
1014119635 6:117709141-117709163 AACCAATGCCATTCAAGTTGTGG - Exonic
1014481710 6:121947097-121947119 CACCAACAGCAAACAAGTTGAGG - Intergenic
1014670163 6:124293613-124293635 CACCAAAATCATTCAAGAAGTGG - Intronic
1019502422 7:1370915-1370937 CAGCAGAAGCATTCAAGCGGAGG - Intergenic
1020517105 7:9136386-9136408 CACCAATATCACTAAAGATGCGG + Intergenic
1021348327 7:19555995-19556017 TACCAATAACGTTCAGGCTGAGG + Intergenic
1021892598 7:25200917-25200939 CAACAATAGCAAACAAGGTGAGG - Intergenic
1021900101 7:25276586-25276608 AACCAATAGCATTCAAGAGAAGG - Intergenic
1027480259 7:78686909-78686931 CACCAGTAGCATTCAAGCAGGGG + Intronic
1028402300 7:90437106-90437128 CACCAATAGCAACCAAGCTGAGG + Intronic
1030531238 7:110713732-110713754 CACCAGTAATATTCAAGCTGAGG - Intronic
1030575083 7:111275833-111275855 TACCAATAACAATCTAGCTGAGG - Intronic
1031390766 7:121211866-121211888 CAGCAACAGCATTCAAGTTCAGG + Intronic
1038879204 8:31588962-31588984 CATCAAGATCATCCAAGCTGAGG + Intergenic
1039668489 8:39565718-39565740 CAACAACAACAGTCAAGCTGAGG + Intergenic
1042963958 8:74330997-74331019 TTCCAATAGCATTCATGCTGAGG + Intronic
1043559014 8:81468949-81468971 GACCAACAGGCTTCAAGCTGGGG + Intergenic
1045698933 8:104843499-104843521 CACCAAAAATGTTCAAGCTGAGG - Intronic
1046496088 8:115015286-115015308 CACCAATAACAATCTAGCTGAGG - Intergenic
1047588498 8:126301049-126301071 CATCAATAGAAATCAAGCTAGGG + Intergenic
1048129785 8:131682393-131682415 CAACAATAGTATACAAGCTTGGG + Intergenic
1048816299 8:138337456-138337478 CACCAATAGCAGACAAACAGAGG + Intronic
1049872768 8:144993928-144993950 GACCAAAAGGATTCAAGTTGGGG - Intergenic
1050204773 9:3184731-3184753 TACCAGTAGTCTTCAAGCTGAGG + Intergenic
1050399124 9:5231935-5231957 CACCAAGAGCCTCCAAGGTGAGG - Intronic
1050586845 9:7121841-7121863 CACCAATAGAATTCAAGCAGTGG - Intergenic
1050989475 9:12130957-12130979 CACCAATAATGATCAAGCTGTGG - Intergenic
1051238456 9:15026071-15026093 CTCCAATAGAACTCCAGCTGAGG + Intergenic
1051724193 9:20071815-20071837 GACCAATAGTCTTCAAGTTGGGG + Intergenic
1051914752 9:22195049-22195071 CACCAACAACAGTCATGCTGAGG - Intergenic
1052364207 9:27593609-27593631 CACCAATAACATTCTAGTTTAGG + Intergenic
1052583481 9:30392589-30392611 CACCAATAATGTCCAAGCTGAGG + Intergenic
1052628889 9:31011313-31011335 CACCAATACTGTTCAAGCTGAGG + Intergenic
1055432827 9:76261470-76261492 CAGCAATAATGTTCAAGCTGAGG + Intronic
1056375405 9:86004435-86004457 CACCAACTGCATTCCAGCTTGGG + Intronic
1058573082 9:106369009-106369031 CACCAATAACATAAAAGTTGAGG - Intergenic
1059734599 9:117088671-117088693 AACCAGTAGCATTCATGCTCTGG + Intronic
1186625557 X:11289620-11289642 CACAAATAGCATTCAAGATGAGG - Intronic
1187615176 X:20985787-20985809 CACCAATAACGTCCAAGCTGAGG + Intergenic
1188644735 X:32551827-32551849 CACCAACAACATTTAAGCTAAGG + Intronic
1190099475 X:47510451-47510473 AACCAATGCCATTCAAGTTGTGG + Intergenic
1190523701 X:51306782-51306804 CACAAACAACAGTCAAGCTGAGG - Intergenic
1191616513 X:63175815-63175837 CACCAATAACAAGGAAGCTGAGG + Intergenic
1191619784 X:63203108-63203130 CACCAATAACAAGGAAGCTGAGG - Intergenic
1193060254 X:77198639-77198661 CACCAATAATGTTCAAGCTGAGG - Intergenic
1194012436 X:88579190-88579212 CACCAATAATGTTCAAGCTGAGG + Intergenic
1194910281 X:99632780-99632802 CACCAATATAGTCCAAGCTGAGG - Intergenic
1198583241 X:138090615-138090637 CACCAACAGTGATCAAGCTGAGG + Intergenic
1199116123 X:143995194-143995216 CACCAGTAATATCCAAGCTGAGG + Intergenic
1199643463 X:149883895-149883917 CAGTAGTAGCAGTCAAGCTGAGG + Intronic