ID: 1093140077

View in Genome Browser
Species Human (GRCh38)
Location 12:15499294-15499316
Sequence AGTAATAAAGAGTTAGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 244}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1093140077_1093140078 -2 Left 1093140077 12:15499294-15499316 CCTTCTACTAACTCTTTATTACT 0: 1
1: 0
2: 0
3: 16
4: 244
Right 1093140078 12:15499315-15499337 CTGCCCATAACAGTAGTTGAAGG 0: 1
1: 0
2: 1
3: 2
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093140077 Original CRISPR AGTAATAAAGAGTTAGTAGA AGG (reversed) Intronic
900833997 1:4985962-4985984 AGAAAAAAAAAGTTAGGAGAGGG - Intergenic
905002202 1:34681416-34681438 AGTAATAAAGGGTGAGCAAAAGG + Intergenic
906028787 1:42699967-42699989 AGTAAGAAAAAGATAGTAAATGG + Intronic
906195196 1:43925969-43925991 AGTAGTGAACAGTGAGTAGACGG + Intronic
907770500 1:57457787-57457809 AGTAAGAAAGAGAAAGAAGATGG + Intronic
907822711 1:57986836-57986858 TGTAATAAACAGTTAATAAATGG - Intronic
908052980 1:60252899-60252921 AGTCCTAAAGAGAAAGTAGAGGG - Intergenic
909292996 1:73907965-73907987 AGTAATAAAATTTTAGTAAATGG - Intergenic
909702913 1:78547633-78547655 AATAATAAAGAGATGGTAGGTGG + Intergenic
911032331 1:93502826-93502848 AGTAATGAAGAGTTGAGAGAAGG + Intronic
912698901 1:111861620-111861642 AGGAATAAGGAGATAGGAGAGGG - Intronic
917170758 1:172171229-172171251 GGTAATATAGAGTAAGTATAGGG - Intronic
917571042 1:176265804-176265826 AGAAATAAAGATTTATTAGAGGG + Intergenic
917948660 1:180005052-180005074 AGAAAAATAGAGTGAGTAGAGGG - Intronic
918540583 1:185627541-185627563 AGTAATAAACACTTAGTTGCCGG - Intergenic
919324211 1:196085709-196085731 CGTAATAAATAATTAATAGAAGG - Intergenic
922245152 1:223788719-223788741 AGTACTAAAGCCTTAATAGAGGG + Intronic
922432695 1:225571448-225571470 AGTTATAAAAGGTGAGTAGAGGG - Intronic
922758943 1:228112692-228112714 AGGAACAAAGACTGAGTAGAGGG + Intergenic
923985209 1:239374115-239374137 AGAAATAAACAGTTAGTCAATGG + Intergenic
1063046729 10:2399788-2399810 AGAAATGAAAAGTGAGTAGAAGG - Intergenic
1064641762 10:17422349-17422371 AGTAATTAAGAGTTATTTTATGG + Intronic
1064693135 10:17938355-17938377 AGAAATAAAGATTTATTATAAGG - Intergenic
1064887843 10:20131858-20131880 TATAATAAAGAGTTAGCAGAAGG - Intronic
1064927559 10:20585952-20585974 AGTAATAAACATTCAGAAGAAGG + Intergenic
1066531913 10:36350254-36350276 AGAAATAAAGAGTTCATAGTAGG - Intergenic
1068656218 10:59578800-59578822 AGTGATAAAGAGTTAGTGCCCGG - Intergenic
1068703385 10:60045246-60045268 AGTAATACAGAGTTAGAATCTGG + Intronic
1068740651 10:60465581-60465603 AGTAAGAAAGTGTGACTAGAGGG + Intronic
1070348351 10:75567360-75567382 AGTAATCATTAGTTAGTAGGGGG - Intronic
1071816393 10:89236058-89236080 AATAATAAAAAGTTACTAAAAGG + Intronic
1074021030 10:109583134-109583156 ATTAATGAAGAGTTAGTTGGTGG + Intergenic
1077726299 11:4678235-4678257 AGTAATAAAGTTTTAATAGTAGG - Intergenic
1078229896 11:9431143-9431165 AGTTCTAAAGTATTAGTAGAAGG + Intronic
1078992467 11:16663942-16663964 ATCAATATAGAGTCAGTAGATGG + Intronic
1081067989 11:38571432-38571454 AGAAATCAAGAAGTAGTAGAAGG - Intergenic
1081515772 11:43827450-43827472 AGTAATCAACAGTTTGTAGAAGG - Intronic
1082058951 11:47844413-47844435 AATAAGAAAGAGATAGTTGAGGG - Intronic
1083014688 11:59440950-59440972 AGCAATAAAAAATAAGTAGAAGG + Intergenic
1084377225 11:68785744-68785766 ATTAATAAAAAGTTACTATACGG - Intronic
1085673402 11:78491043-78491065 ATTAATAAAGAATTAGGGGATGG + Intronic
1086850984 11:91808159-91808181 AGGAAAAAAAAATTAGTAGAAGG - Intergenic
1087628160 11:100620772-100620794 AGTGAAAGAGAGATAGTAGAGGG + Intergenic
1088284464 11:108172096-108172118 AGTAATAACTAATGAGTAGATGG - Intronic
1088912135 11:114199559-114199581 AGCAATAATGAATTAGGAGAAGG + Intronic
1089847987 11:121473473-121473495 AGAAACAAAGAGTTAGGAAAAGG - Intronic
1089967930 11:122669021-122669043 AGTCATAATGAGTTAGCAGGTGG + Intronic
1090292968 11:125562249-125562271 AGGAACAAAGACTGAGTAGAGGG - Intergenic
1090519470 11:127462884-127462906 AGAAATAAAAAGTTAATAAAAGG + Intergenic
1090837672 11:130465133-130465155 AGGAAGAAAGAGTTAGTAATGGG - Intronic
1091869645 12:3877750-3877772 AGAAAGAAAGAGTCAGTTGATGG - Intergenic
1093140077 12:15499294-15499316 AGTAATAAAGAGTTAGTAGAAGG - Intronic
1095253564 12:40006636-40006658 AGTAGTAAAGATTTAGGTGAAGG + Intronic
1095573767 12:43711046-43711068 AAAAATAAAGAGTTAGGGGAGGG - Intergenic
1097458390 12:59830326-59830348 AGTATAAAAGAGTTAATAAAAGG + Intergenic
1097900572 12:64869213-64869235 GGTAGTAAAAAGTTAGCAGATGG - Intronic
1098269489 12:68755948-68755970 AGAGATAAAGAGTTAGTAACTGG + Intronic
1098295490 12:68999949-68999971 AGTAATAAGGGTTTAGTGGATGG + Intergenic
1099376915 12:81903506-81903528 GGTAATTAGGAGCTAGTAGAAGG - Intergenic
1100150514 12:91731084-91731106 ACTAGTAAAGAGTTTGAAGAAGG - Intergenic
1100216901 12:92460076-92460098 GGTAATAAGGAGTGAGCAGAAGG - Intergenic
1100225546 12:92552305-92552327 AGAAATAAAGAGGTAGAAAAGGG - Intergenic
1103849534 12:123923127-123923149 ATTAATAAAGAGTCTGTTGATGG + Intronic
1105264876 13:18807178-18807200 ACTAGCAAAGAGCTAGTAGAAGG - Intergenic
1107230345 13:38102149-38102171 ACTAATGAAGAGAAAGTAGAAGG - Intergenic
1107369275 13:39725279-39725301 AGGATTAAAGAGTTAATACAGGG - Intronic
1107518066 13:41151074-41151096 AGTAATAACCAGTTACTATAAGG - Intergenic
1109450290 13:62505426-62505448 AATTATACAGAGTTACTAGAGGG - Intergenic
1109568539 13:64153413-64153435 ATTAAGAAAGAGCTGGTAGATGG + Intergenic
1109953889 13:69540263-69540285 AGTAATAAAGACTTGCTCGAGGG + Intergenic
1110196725 13:72797655-72797677 AGTAATGGAGTGTCAGTAGAAGG + Intronic
1110652322 13:77956565-77956587 AGTAATAAAAAGCTAATACAAGG - Intergenic
1110998256 13:82141198-82141220 ACCAATAAAGATTTAATAGAAGG - Intergenic
1112925396 13:104668012-104668034 AGTAATAAAGGCCCAGTAGATGG + Intergenic
1113072144 13:106432281-106432303 AAATATAAAGAGTAAGTAGAGGG + Intergenic
1114239305 14:20851428-20851450 ACTAATAAACAGTTTGTGGAGGG - Intergenic
1115180293 14:30617696-30617718 AGAAGTAAAGAGTTTATAGAAGG - Exonic
1116539270 14:46078622-46078644 GGAATTAAAGAGTTAGAAGAAGG - Intergenic
1117723400 14:58648531-58648553 TGTAATAAAAAGTTGGGAGAAGG - Intergenic
1121359079 14:93239508-93239530 ATTAAAAAAGATTTAATAGATGG + Exonic
1123179126 14:106451450-106451472 AGTTTTAAATAGTTAGAAGAAGG - Intergenic
1123960475 15:25393933-25393955 AGTAATGTAGAGTTAGCTGATGG - Intronic
1125141372 15:36411625-36411647 AATAATTAAGACTTAGTAGGTGG - Intergenic
1126158689 15:45588324-45588346 AGTAAACAAGAGTTAAGAGAGGG - Intronic
1126256694 15:46635582-46635604 AATTTTAAAGAGATAGTAGAAGG - Intergenic
1127542583 15:59956020-59956042 AATAATAAAGAGATAGGAGATGG - Intergenic
1129139594 15:73585274-73585296 AGTAATAGAGAGTTAAGAGGTGG - Intronic
1130214282 15:81953605-81953627 AGTAATAAAAAGTAACTAGAGGG - Intergenic
1130675861 15:85951395-85951417 TGTACTAAATACTTAGTAGATGG + Intergenic
1130723171 15:86409990-86410012 TGAAATAAAGAGTTAGAAGTGGG - Intronic
1131326112 15:91447674-91447696 ATTATTAAAGAGATAGGAGAAGG - Intergenic
1139012627 16:62650947-62650969 ATTACTAAAGATTTGGTAGATGG + Intergenic
1140306851 16:73811146-73811168 ATTAACAAAATGTTAGTAGAGGG - Intergenic
1141319399 16:82993170-82993192 AGTCATAAAATGTTAGCAGAAGG - Intronic
1144471841 17:15550021-15550043 GGAAATAAAGAGTTAGAAAATGG - Intronic
1144924636 17:18794663-18794685 GGAAATAAAGAGTTAGAAAATGG + Intronic
1145804767 17:27718695-27718717 AGGAATTAAGAGCTAGTGGAAGG - Intergenic
1145904963 17:28511250-28511272 AATAATACAGATTTAGTACAAGG - Intronic
1147679834 17:42234969-42234991 AGTAGTAAAGAGTAAGAAGTAGG + Intronic
1149408111 17:56375614-56375636 AGAAATAGAGATTTAGAAGAAGG + Intronic
1153716554 18:7855554-7855576 AAGAATTAAGATTTAGTAGAGGG - Intronic
1154327600 18:13403140-13403162 AAGAATAAAGACTTAATAGACGG + Intronic
1155715166 18:28933179-28933201 ATTCATAAAGAGTTAGTATTTGG + Intergenic
1156879297 18:42057439-42057461 AGTAATAATAAGTTAGCAGAAGG + Intronic
1158938684 18:62387353-62387375 AGTAATGAACAGTTATTAGGGGG + Exonic
1159171540 18:64774949-64774971 AATAATAAAGAGTTAGAATTTGG - Intergenic
1159885494 18:73900054-73900076 AGAAAACCAGAGTTAGTAGATGG - Intergenic
1164918502 19:32071174-32071196 AGTACTGAAGAGTCAATAGAAGG + Intergenic
1167993788 19:53385775-53385797 AGAAATAAACAGTTTGTAAACGG + Intronic
1168006621 19:53495113-53495135 AGAAATAAACAGTTTGTAAATGG + Exonic
926550178 2:14291900-14291922 AGTAAGAAAGAGATAGCAGAAGG + Intergenic
928958840 2:36901101-36901123 AGGGATAAAGAGTTAGGGGAGGG - Intronic
929162513 2:38846635-38846657 AGAAAGAAAAAGTAAGTAGAGGG + Intronic
930097168 2:47573585-47573607 AATAAGTAAAAGTTAGTAGAAGG - Intergenic
930736089 2:54780002-54780024 AATAATACAGAGTTAGGAGGTGG + Intronic
931249616 2:60518482-60518504 ATGAATAAAGAGTGAGCAGAAGG + Intronic
931476309 2:62591108-62591130 AGCAAAAAAGAGTTGGTGGATGG - Intergenic
931527141 2:63169180-63169202 AGTAACAAAGTGTCAGTACAAGG - Intronic
935311369 2:101787203-101787225 AGTAATCCAGAGTTAGGTGAAGG + Intronic
936929444 2:117772415-117772437 AGTGAAAACGAGTCAGTAGATGG - Intergenic
937568763 2:123331799-123331821 AGAAACAAAGAGATACTAGATGG + Intergenic
939960992 2:148565611-148565633 TCTAATAAAGAGTTATTATATGG - Intergenic
941573107 2:167196110-167196132 AATAATAAAGAGTCAGTTAAAGG - Intronic
942389218 2:175475085-175475107 AGTAAAAAAGTGTCAGAAGAGGG + Intergenic
942485460 2:176435138-176435160 GGTAAGAAAGAGATAGTTGAAGG - Intergenic
943778280 2:191792295-191792317 AGCAAGAAAGAGTTAGTTCATGG - Intergenic
943962135 2:194279292-194279314 ATTAACAAAGAGTTAAAAGATGG - Intergenic
944358799 2:198826607-198826629 ATAAATACAGAGTTAATAGAAGG + Intergenic
944505225 2:200404120-200404142 AGTGAGAAAGAATTAGAAGAGGG - Intronic
945353507 2:208810860-208810882 AAGAATACAGAGTTAGTAAATGG + Intronic
945873152 2:215249143-215249165 AGTCAGAAAGAGTTTGGAGAAGG - Intergenic
946803035 2:223441701-223441723 AGAAATACAGAGTTGGGAGAGGG + Intergenic
947274411 2:228373941-228373963 AGAATGAAAGAGTTAGAAGATGG + Intergenic
947307773 2:228765982-228766004 AGAAATAAAGAGGTAGTGGAAGG + Intergenic
947322678 2:228939444-228939466 AATAATAAAGAATTAATAGTTGG - Intronic
1175295532 20:57906406-57906428 AATAACAAAGACTTGGTAGAAGG - Intergenic
1176849953 21:13905640-13905662 ACTAACAAAGAGCTAGTACAAGG - Intergenic
1178052959 21:28768051-28768073 TGTGAGAAAGAGTTAGAAGAGGG + Intergenic
1178187363 21:30238222-30238244 AGTAATAAACACTGACTAGAAGG + Intergenic
1180715564 22:17869827-17869849 AGTAATAAAAAGTTACTTAATGG + Intronic
1181748475 22:24972611-24972633 AGAAATAAAGAATAAGTGGATGG - Intronic
949252143 3:1998124-1998146 AGTATAAAAGACTTTGTAGATGG + Intergenic
952035192 3:29191975-29191997 ACTAATAATGAGTAAGGAGACGG - Intergenic
952661708 3:35858381-35858403 AGAAAAAAAGAGGTAGAAGAAGG - Intergenic
955784623 3:62524101-62524123 AGTAATAAAGAGTTAGTTTCTGG - Intronic
955984187 3:64555965-64555987 AGCAATAAAGAGTTCGTATCTGG + Intronic
956404658 3:68915665-68915687 AGTAAGAAAGAATTAGAACAGGG + Intronic
956669660 3:71674765-71674787 TGTGGTAAAGAGTTAGTAAATGG - Intergenic
956684844 3:71816468-71816490 AGTGTTAAACAGTAAGTAGAAGG + Intergenic
958583611 3:96057924-96057946 AGTAAAAAAGAGGAAGAAGAAGG - Intergenic
958848674 3:99295793-99295815 AGTCATATAGAGTTACTTGAAGG + Intergenic
959372419 3:105544351-105544373 AGTAATAAAGGCTTTGTAAAGGG - Intronic
959727118 3:109556673-109556695 ACAAATAAAGAATAAGTAGAGGG - Intergenic
960329976 3:116347206-116347228 TGTCATAAAGAGTGAATAGAAGG - Intronic
960645130 3:119871909-119871931 AGTAATAACTGGTTAGTAGAAGG - Intronic
961996489 3:131250119-131250141 AGAAATAAAAATTCAGTAGAAGG + Intronic
962106003 3:132390213-132390235 AGAAGTAAAGAGTTTATAGAAGG - Intergenic
962345547 3:134616481-134616503 AGGTAAAGAGAGTTAGTAGAGGG + Intronic
963375141 3:144455072-144455094 AGTTCTAAAGAGTTAGTACTTGG + Intergenic
963923767 3:150930132-150930154 TGTAATCAAGGGATAGTAGAGGG + Intronic
964579363 3:158214960-158214982 AGTAATCAACAACTAGTAGATGG - Intronic
965681684 3:171258402-171258424 AGTAATAAAGGCCTAGGAGATGG + Intronic
969946921 4:10793037-10793059 AGAAATACAGAATTAGTAGAGGG + Intergenic
973828345 4:54732458-54732480 AGTAATAAACACTTGGGAGAAGG + Intronic
974612669 4:64236450-64236472 AGTAATCAAGAGTAAACAGAGGG + Intergenic
975196760 4:71534418-71534440 AGTACTAAAAAGAAAGTAGAAGG - Intronic
975775346 4:77780540-77780562 AGAAATAAAGAGTGAATGGATGG - Intronic
976470312 4:85420731-85420753 AGTAAGAAAAAAGTAGTAGAGGG + Intergenic
977272170 4:94930537-94930559 ACTAATAAGGATTTAGTATAGGG + Intronic
977685818 4:99846609-99846631 AATAATAAAGAATTAGTTTAGGG + Intronic
977953744 4:103003048-103003070 AGTAAGTAACAGTGAGTAGAAGG - Intronic
978109401 4:104944567-104944589 TGTAAGAATGAGTTAGTATAAGG - Intergenic
978832606 4:113106899-113106921 AGTAATAAATAGGCAGGAGATGG - Intronic
979471015 4:121096484-121096506 AGAAATAAAAAATTTGTAGAGGG - Intergenic
981408729 4:144402440-144402462 AGGACTAAAGAGTTAGCTGACGG + Intergenic
981626461 4:146761707-146761729 ACTAAAAAAGAGTAAGTAAAAGG - Intronic
982493221 4:156056027-156056049 AGTAATAAAGATATATTAGAGGG - Intergenic
982911987 4:161153911-161153933 ACTAATAAACTGTTAGAAGAAGG + Intergenic
985495962 5:206182-206204 AGCAACAAACAGTTAGAAGACGG - Intronic
987779418 5:22415189-22415211 AGTAATAAAGAAATAATAAAGGG + Intronic
987882139 5:23761947-23761969 AGTAATCATGAGTTAGTTTAAGG - Intergenic
988417578 5:30965119-30965141 ACTAATAACCAGTCAGTAGATGG - Intergenic
989428022 5:41318226-41318248 AGCAATAAATAATCAGTAGAAGG + Intronic
989474501 5:41858414-41858436 AGTATTAAAGAGCTATAAGATGG - Intronic
989783042 5:45292821-45292843 ATTTATAAAGAATGAGTAGATGG - Intronic
990227336 5:53669387-53669409 AGTATTAACGAGGTTGTAGAGGG - Intronic
990919910 5:60951328-60951350 AGCAATAAAAAGAAAGTAGATGG - Intronic
992294415 5:75313425-75313447 ATAAATAAATAGTTTGTAGAGGG - Intergenic
992301492 5:75386746-75386768 AGTAATAAATAGGTAGGGGAAGG - Intronic
992876330 5:81059499-81059521 AGTAAGAAAGAGGTAGAAGAGGG - Intronic
993101247 5:83542226-83542248 ATTAATGAAGAGTCAGTGGAAGG + Exonic
993243961 5:85427787-85427809 AGTCATAAAGAATTAGTCTAGGG + Intergenic
993441966 5:87968197-87968219 AGTAATAAAAAGCTAGAACAAGG - Intergenic
993492985 5:88574390-88574412 AGTAATAAAGAGCTAGTCTGAGG - Intergenic
993548412 5:89242775-89242797 GGTAAGAAAGAGTAAGAAGATGG + Intergenic
995767821 5:115638118-115638140 AGTATCAAAGAGTTAGTGGGAGG - Intergenic
996732743 5:126731423-126731445 ACAAATAAAGAGTAAATAGAAGG + Intergenic
997435210 5:133869037-133869059 AGTAATATAGAAATATTAGATGG + Intergenic
999643320 5:153693754-153693776 AGTAAATCAGAGTTAGTAGTTGG - Intronic
1007059512 6:38924716-38924738 AATAATGAAGAGTTATAAGAAGG - Intronic
1008225973 6:48917310-48917332 AGTAATCAAGTGTTATTAAATGG + Intergenic
1009669425 6:66727805-66727827 AGAAATAAAGAGAAAGTATATGG - Intergenic
1010232758 6:73549795-73549817 AGAAATAAAGAGTTAGCATGGGG + Intergenic
1010942724 6:81937811-81937833 AGAAAGAAAGTGTTAGTGGATGG + Intergenic
1011041797 6:83037517-83037539 AGGAAAAATGAGTTAGTAAAAGG - Intronic
1011527898 6:88285823-88285845 ACTAAAAAACAGTTAGTATATGG - Intergenic
1012459449 6:99444382-99444404 AGTAATAAAGAAATGGGAGAAGG - Intronic
1012623864 6:101382515-101382537 AGAAATGAAGAGTGAGTGGAAGG - Intergenic
1013333118 6:109126443-109126465 AGTAATTAAATGTTAATAGATGG - Intronic
1013965067 6:115945836-115945858 AGTTATAAAGAATTAGTAGTGGG - Intronic
1014053732 6:116988704-116988726 TGTAATAGAGAGTGAATAGAGGG + Intergenic
1016621474 6:146114282-146114304 AGTTACAAAGAGTTTGAAGATGG + Intronic
1017094601 6:150793462-150793484 AGTAACCAAGAGTTCATAGAAGG + Intronic
1017834667 6:158166860-158166882 TGTGATAAAGAGTGACTAGAGGG - Intronic
1020249099 7:6452926-6452948 AAAAAAAAAGAGTAAGTAGAAGG + Intronic
1026685313 7:72504679-72504701 AATAATAAAGAGGTAGTAGTTGG + Intergenic
1026927359 7:74203912-74203934 AGAAAAAAAGAGATAGAAGAAGG + Intronic
1027512180 7:79096504-79096526 AGTAATTTAGAGTTAAAAGAAGG - Intronic
1030251754 7:107452980-107453002 AGTACTAAAGATTAAGTATAAGG - Intronic
1030768860 7:113447580-113447602 ATCAATAGAGAGTTTGTAGAGGG + Intergenic
1033676799 7:143549316-143549338 AGGAAAAAAGAAATAGTAGAGGG - Intergenic
1033695036 7:143780119-143780141 AGGAAAAAAGAAATAGTAGAGGG + Intergenic
1035882373 8:3256446-3256468 ATCAATAAAAAGTTAGGAGAAGG - Intronic
1041599353 8:59697741-59697763 AGAAATAAAAAATTAATAGAAGG + Intergenic
1043047444 8:75344512-75344534 AGTGTTAAAGAGTTTGTATATGG + Intergenic
1043583394 8:81739069-81739091 AGAAAAAAAGAGTAAGCAGAGGG - Intronic
1044460342 8:92437181-92437203 AGTGATAATGACATAGTAGATGG - Intergenic
1044953960 8:97460548-97460570 TGTAATAAAGAAATAGAAGAAGG - Intergenic
1046457745 8:114489591-114489613 AGGAATAAACAGTTAGTTCAAGG + Intergenic
1046742857 8:117846968-117846990 AGCAATAGAGAGTTAGCACAGGG - Intronic
1046904971 8:119562668-119562690 AAAAATAAAGAGTCATTAGAAGG + Intronic
1050617232 9:7414440-7414462 AGTAGAAAAGAGGTGGTAGATGG + Intergenic
1052725048 9:32219278-32219300 AGTATTAAAGTGTTTCTAGAAGG + Intergenic
1058770570 9:108227285-108227307 AGTAAGAAAGAGAGAATAGAAGG + Intergenic
1059100187 9:111463945-111463967 GGTGATAAACAGTTTGTAGATGG - Intronic
1060758709 9:126230830-126230852 AGTAATAACAAGTCAGGAGACGG - Intergenic
1061532993 9:131229448-131229470 AGTACCACAGAGTTGGTAGAAGG + Intronic
1186238353 X:7539084-7539106 ATTAATAAAGAGGCAGTAGTAGG + Intergenic
1187641017 X:21289827-21289849 AGTAATAATGAGTTCTGAGATGG - Intergenic
1187674882 X:21706361-21706383 AGAAATAAAGAGGCAGAAGATGG - Exonic
1189457647 X:41207811-41207833 ACTAGTACAGAGTAAGTAGAGGG - Intronic
1189935991 X:46068257-46068279 AGCAATATAGAGTTAGAACAAGG + Intergenic
1190441240 X:50476472-50476494 AGTCATAAAGCGTTTGTAGAGGG - Intergenic
1190486833 X:50935198-50935220 AGTTAAAGAGAGTTATTAGAAGG + Intergenic
1192964973 X:76167636-76167658 AGTAACAAAGAGTTAATACCAGG - Intergenic
1194159160 X:90429374-90429396 AGAAATAAAGAGTTATTTGTTGG - Intergenic
1194397814 X:93407649-93407671 AGTTATAAAGAGTTAGATGCAGG + Intergenic
1194548392 X:95267564-95267586 AGTAATAAACACTCAGTAAATGG - Intergenic
1195663920 X:107410793-107410815 ACCAATAAAGATTTAGTGGAGGG - Intergenic
1198706343 X:139452589-139452611 ATTAATAAAGAGCAAATAGAAGG + Intergenic
1199154283 X:144528080-144528102 ACTAAGCAAAAGTTAGTAGAAGG + Intergenic
1199157281 X:144565317-144565339 AGTAAAAAAGAGCAAATAGAGGG - Intergenic
1199256755 X:145726278-145726300 AATAGGAAGGAGTTAGTAGATGG + Intergenic
1199435149 X:147804646-147804668 AGGTAGAAAGAGATAGTAGAAGG + Intergenic
1200505467 Y:4006342-4006364 AGAAATAAAGAGTTATTTGTTGG - Intergenic
1200714952 Y:6527982-6528004 AGTAATAAAGTGGTAGTCCAGGG - Intergenic
1201018872 Y:9633149-9633171 AGTAATAAAGTGGTAGTCCAGGG + Intergenic
1201851216 Y:18482946-18482968 TGTAATAAAGACTTAATTGAGGG - Intergenic
1201882103 Y:18837432-18837454 TGTAATAAAGACTTAATTGAGGG + Intergenic
1202347625 Y:23950449-23950471 TGTAATAAAGACTTAATTGAGGG + Intergenic
1202523147 Y:25719642-25719664 TGTAATAAAGACTTAATTGAGGG - Intergenic