ID: 1093140615

View in Genome Browser
Species Human (GRCh38)
Location 12:15506564-15506586
Sequence CACCTTATTCAGAGGGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2064
Summary {0: 1, 1: 1, 2: 117, 3: 628, 4: 1317}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093140615 Original CRISPR CACCTTATTCAGAGGGTGGC AGG Intronic
Too many off-targets to display for this crispr