ID: 1093143060

View in Genome Browser
Species Human (GRCh38)
Location 12:15532692-15532714
Sequence GATTATGCAAAGTTGGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 163}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1093143060 Original CRISPR GATTATGCAAAGTTGGAAGT TGG (reversed) Intronic
901760285 1:11466714-11466736 GATGATGCCAAGCTGGAGGTTGG + Intergenic
904819061 1:33228753-33228775 GACAAGGCAAAGTTGGAAGCAGG - Intergenic
906281232 1:44555362-44555384 GATCATACAAAGTTGAAAGCCGG - Intronic
909807359 1:79888454-79888476 GATTAGGCAAAACTGGAAGAAGG - Intergenic
912184106 1:107253778-107253800 GTTTATGCAATGTGGGATGTTGG - Intronic
916455331 1:164965338-164965360 GAGGATGCCAAGTTGGAAGATGG - Intergenic
916997353 1:170315213-170315235 GATTATGCCTAGCTGGTAGTTGG - Intergenic
918744608 1:188183743-188183765 TATTATGCAAAATTTGCAGTTGG + Intergenic
920188351 1:204176491-204176513 CATTATGGAAAGTGGGAAGAAGG + Intergenic
920729180 1:208466875-208466897 GATCAAGCGAAGCTGGAAGTTGG - Intergenic
921314352 1:213876302-213876324 CATTAAGCAAAGTGGGAAGAAGG - Intergenic
1065699287 10:28409357-28409379 GATTCTGCAAAGCAGAAAGTAGG + Intergenic
1065708085 10:28489528-28489550 GATTAGGCAAAGGGAGAAGTTGG - Intergenic
1066113176 10:32215384-32215406 AATTATGCAAAATTGAAAATAGG - Intergenic
1068072992 10:52219454-52219476 GAATATGCAAAGTGAGATGTTGG - Intronic
1068129572 10:52880929-52880951 GATAATTCAAAATTGTAAGTGGG - Intergenic
1070634740 10:78116278-78116300 GATTATAAAGAGTTGGAAATAGG + Intergenic
1072705327 10:97676882-97676904 GATTATTCAGGGTTTGAAGTGGG - Intergenic
1072920624 10:99574064-99574086 AAGCATGCTAAGTTGGAAGTTGG + Intergenic
1073135874 10:101220003-101220025 GTTTATGCAAACATGGGAGTAGG - Intergenic
1075246064 10:120823122-120823144 GATTAGGCAGAGATGGGAGTGGG + Intergenic
1078265648 11:9754592-9754614 GATATTGCCAAGTAGGAAGTAGG - Intergenic
1081005463 11:37731209-37731231 GATTATCAAAAGGGGGAAGTGGG + Intergenic
1083481957 11:62954731-62954753 GATATTTCAAAGTTGGAGGTGGG + Intronic
1085989979 11:81829804-81829826 AGTTATGCAAAGTTGACAGTAGG + Intergenic
1090064315 11:123490137-123490159 GAAAATGCAAACTTGGAATTTGG + Intergenic
1093143060 12:15532692-15532714 GATTATGCAAAGTTGGAAGTTGG - Intronic
1093255548 12:16862744-16862766 GTTTATTCACAGCTGGAAGTAGG - Intergenic
1095199588 12:39367143-39367165 GATGATGCAGTGTTTGAAGTTGG - Exonic
1097818340 12:64099967-64099989 GTTTATACAAAGTTGGAAAGTGG - Intronic
1098088181 12:66871092-66871114 GATTAAACAAAGTTAGAGGTTGG + Intergenic
1099688157 12:85915858-85915880 ATTTATGCAAACTTGGGAGTGGG + Intergenic
1100504099 12:95202937-95202959 GATTATGCACAGTTAGAAGGTGG - Intronic
1103206578 12:119134195-119134217 GAATATGCAAATTTGGGGGTTGG + Intronic
1104067096 12:125315096-125315118 GCTTATGCACAGAAGGAAGTAGG + Intronic
1107065659 13:36212102-36212124 GAACATGCATAGTGGGAAGTCGG + Intronic
1107458641 13:40579169-40579191 GATTATGCCAAGGTAGAAGGAGG + Intronic
1108178731 13:47820492-47820514 GATATTGGAAAGTTGCAAGTAGG + Intergenic
1108610075 13:52076771-52076793 GATAATGCTAAGTAGGCAGTTGG - Intronic
1110342168 13:74404251-74404273 GGTTTTGCATAGTTGGAGGTGGG + Intergenic
1110958657 13:81591833-81591855 GTTGATCCAAAGTTGGAAGTGGG - Intergenic
1111296785 13:86289755-86289777 GTTTATGCAAAGTTCTAAGGTGG - Intergenic
1112186387 13:97132001-97132023 GAATATGATAAGTTGGAAATTGG + Intergenic
1113184415 13:107671369-107671391 GATTATTCAAAGTTGGGGCTGGG + Intronic
1115142411 14:30187978-30188000 GAAAATGCAAACTAGGAAGTAGG - Intronic
1115728254 14:36240285-36240307 GATTATTTAATGCTGGAAGTAGG + Intergenic
1116474767 14:45326647-45326669 GATTATATAAATTTGGAGGTAGG - Intergenic
1117522845 14:56567882-56567904 GATTATCTAATCTTGGAAGTTGG - Intronic
1117873933 14:60230811-60230833 TTTTATGCATTGTTGGAAGTGGG + Intergenic
1118129247 14:62944115-62944137 CATAATGCTAAGTTGGATGTGGG - Intronic
1118948795 14:70415232-70415254 TATTATTAAAAATTGGAAGTTGG - Intronic
1121982761 14:98469014-98469036 GGTTTAGCATAGTTGGAAGTTGG + Intergenic
1122851480 14:104534897-104534919 GTTGATCCTAAGTTGGAAGTGGG - Intronic
1123576928 15:21679877-21679899 GATAATTCAAAGATGGAAGTGGG + Intergenic
1123613550 15:22122345-22122367 GATAATTCAAAGATGGAAATGGG + Intergenic
1127639619 15:60903756-60903778 AATTATGCAAAATCGGAGGTCGG + Intronic
1202985796 15_KI270727v1_random:414122-414144 GATAATTCAAAGATGGAAGTGGG + Intergenic
1134878455 16:17723405-17723427 CATTTTGCAAATTTGGAATTTGG + Intergenic
1135318766 16:21475976-21475998 GAATTTGCAAAGTTGAAAATAGG - Intergenic
1135371658 16:21907769-21907791 GAATTTGCAAAGTTGAAAATAGG - Intergenic
1135440129 16:22462935-22462957 GAATTTGCAAAGTTGAAAATAGG + Intergenic
1138871366 16:60891475-60891497 GATTTTTTAAATTTGGAAGTTGG + Intergenic
1139411832 16:66768420-66768442 GATTATAAAAAGAAGGAAGTAGG + Intronic
1140263474 16:73400545-73400567 GATTATGCAAGATTGGAAGACGG - Intergenic
1145786624 17:27597926-27597948 GACCATGTAAAGTTGGAATTAGG + Intronic
1149070545 17:52536782-52536804 GATTAAGGAAAGTTGGAAGGAGG - Intergenic
1149450007 17:56742621-56742643 CACTATGTAAAGATGGAAGTAGG + Intergenic
1149864385 17:60142565-60142587 TATTATGCAAATGGGGAAGTGGG - Intergenic
1155796621 18:30045586-30045608 GATTATTTAAAGCTGGGAGTTGG + Intergenic
1156812647 18:41271637-41271659 GAATCTGCAATGTTGGAAGTGGG + Intergenic
1158341580 18:56472347-56472369 GCTTATGGAAAGTGTGAAGTAGG - Intergenic
1160121723 18:76136232-76136254 GATTATGCAAAGCAGGAATGTGG + Intergenic
1162668543 19:12236128-12236150 GATGAAGCAAAGTTGGCACTTGG + Intronic
1165141152 19:33700707-33700729 CATTATGCACAATTGGAGGTGGG + Intronic
1167605098 19:50477475-50477497 GAGTATGCAAGTTTGGAGGTTGG + Intronic
925798415 2:7571656-7571678 AATTTTGCAAAGTTGCTAGTAGG + Intergenic
927366009 2:22297188-22297210 GTTTATGTAAAGTTCAAAGTGGG + Intergenic
932012151 2:67989286-67989308 CTTTATGCAAACTTGGGAGTGGG + Intergenic
935443244 2:103127238-103127260 AATTGTGCAATTTTGGAAGTTGG + Intergenic
935785158 2:106542029-106542051 GTTTATGGAGAGTTGGAAGAAGG - Intergenic
937517035 2:122667081-122667103 GATAATGAAAGGTTGGAAATAGG + Intergenic
937757121 2:125553475-125553497 GAATATACACAGTTTGAAGTGGG + Intergenic
941334135 2:164220212-164220234 GATTAGGCAAGATTGGAAGGAGG - Intergenic
942839309 2:180340388-180340410 GAGTATGCAAAGATGGTAGAGGG + Intergenic
943916511 2:193641704-193641726 GATTATCCACTGTTGAAAGTGGG + Intergenic
944413046 2:199460186-199460208 GAAAATGCACAGTTCGAAGTCGG + Intronic
945370861 2:209015780-209015802 CGTTATACAAAGTTGGCAGTCGG + Intergenic
948027684 2:234790983-234791005 GATTCTGCAAGGTTGGAGCTCGG - Intergenic
1174315282 20:49695144-49695166 GATTATGAAAAATTGGAGTTAGG - Intronic
1176921430 21:14692053-14692075 TATTATGCCACGTTTGAAGTGGG - Intergenic
1178138516 21:29655541-29655563 CATTATGCTAAGTCGTAAGTAGG - Intronic
1179377825 21:40867331-40867353 GATTATACTGAGTTGGGAGTGGG - Intergenic
950246981 3:11429527-11429549 GATTTTTCAAAGTTGGAAATGGG - Intronic
950381002 3:12614791-12614813 GTTTCTGAAAAGCTGGAAGTTGG - Intronic
951095015 3:18618915-18618937 GGTTCTTCACAGTTGGAAGTAGG + Intergenic
951797126 3:26551847-26551869 CTTTAGGCAAAGTTGGAATTAGG - Intergenic
952409909 3:33038793-33038815 GATTAAGCTAATTTGAAAGTGGG - Intronic
952571617 3:34724564-34724586 GATTATTCAAAGGAGGAAGAAGG - Intergenic
957156883 3:76555263-76555285 AATTATCCAAAGTTAGAACTTGG + Intronic
960632358 3:119744796-119744818 GAAGATGTAAATTTGGAAGTTGG + Intronic
961975454 3:131020076-131020098 GTTTATGAAAAGTTGTAACTTGG - Intronic
963366134 3:144336864-144336886 TCTTATGTAAAGTTGGAAGAAGG + Intergenic
963662761 3:148148516-148148538 AATTATGAGAAGTTGGAACTCGG + Intergenic
963670180 3:148241742-148241764 GATTATGGAAAAGTGGTAGTTGG - Intergenic
965153147 3:165009208-165009230 GATTATGCAAAATTAGTACTTGG - Intronic
967857383 3:194128689-194128711 GATTATAGAAAGATGGAAGCTGG - Intergenic
968747212 4:2366311-2366333 GCTTATGCAAAGCTGCACGTGGG + Intronic
969455664 4:7298330-7298352 GAGTATGGGAAGTTGGAGGTGGG + Intronic
970506015 4:16731272-16731294 GTTTGTACAAAGTGGGAAGTTGG - Intronic
971557991 4:28037998-28038020 GAATCTGCAACGTTGGAGGTGGG - Intergenic
971763329 4:30797572-30797594 CATTATTAAAAGTAGGAAGTGGG - Intronic
973011039 4:45073492-45073514 GACTATGTAAACTTGGAAATTGG + Intergenic
973136865 4:46719570-46719592 GATTATCCAAATTTTGAACTAGG + Intergenic
974193622 4:58540406-58540428 GATGAGATAAAGTTGGAAGTGGG + Intergenic
974705897 4:65515031-65515053 GATTATAAATAGGTGGAAGTTGG - Intronic
976115962 4:81726768-81726790 GATTATCCAATGCTGAAAGTTGG - Intronic
976656172 4:87490992-87491014 AAATTTGCAAATTTGGAAGTGGG + Intronic
979436104 4:120693197-120693219 GATTACACAAAATTGGAATTTGG + Exonic
982131681 4:152234163-152234185 GAGTCTGCAAGGTTGGAAGGAGG - Intergenic
982278610 4:153661953-153661975 GATTATGAAGAATGGGAAGTTGG + Intergenic
985174988 4:187191273-187191295 GCTTATGGAAAATTGGAAGCAGG + Intergenic
985365392 4:189226562-189226584 GTTTATTCAATGCTGGAAGTGGG - Intergenic
987240498 5:15993633-15993655 GGTTATGCACAGCTGCAAGTAGG - Intergenic
988709299 5:33757449-33757471 GATCATGCAGAATTGGAAGCTGG + Intronic
990795777 5:59538888-59538910 GCATATGCAAAGTTGGAAAGTGG - Intronic
990905532 5:60798774-60798796 ATTTATGCAATGTTGAAAGTAGG - Intronic
991428414 5:66516512-66516534 GATCATGCAAACTTGAACGTCGG + Intergenic
992048119 5:72917752-72917774 GAAGATGGAAAGCTGGAAGTTGG + Intergenic
992481767 5:77158636-77158658 GGTTGTGCAAAGTTGGTAGAAGG - Intergenic
999555721 5:152740132-152740154 GATTTTGGAAAGTTGGAAAGTGG - Intergenic
1000194402 5:158943882-158943904 GATTATGCAAAATCAGCAGTTGG + Intronic
1000413230 5:160956093-160956115 GGTGATCCAAAATTGGAAGTGGG + Intergenic
1003190481 6:3870187-3870209 GATTGTGCAAAGACGGAAGGGGG - Intergenic
1004516043 6:16323166-16323188 AATTTTGCAAAGTTTGGAGTAGG + Intronic
1008458435 6:51739450-51739472 GATCACCCAAAGTTGGGAGTTGG - Intronic
1010386983 6:75291450-75291472 GTTTTTGCAAAGTGGGATGTGGG - Intergenic
1012383073 6:98643329-98643351 AGTTATGCAAATTTGCAAGTAGG - Intergenic
1014238045 6:118982700-118982722 GATTCAGCAAATTTTGAAGTAGG - Intronic
1015646257 6:135391956-135391978 GATTAGGAAAACTTGGTAGTAGG + Intronic
1021387243 7:20046089-20046111 GATTATAAAAACTTGGAGGTAGG - Intergenic
1022241987 7:28521330-28521352 GATTATCTGAAGTTGGAAGAGGG + Intronic
1023306191 7:38830585-38830607 AAATATGCAAAGTTGAATGTGGG + Intronic
1028977728 7:96932692-96932714 GATTTTTCACAGTTGGAATTTGG + Intergenic
1030494512 7:110281787-110281809 AATTATGCTAAGTGGAAAGTGGG + Intergenic
1031054591 7:116979437-116979459 GAAAATGCAAACCTGGAAGTTGG - Intronic
1031478287 7:122248799-122248821 GATTAGGCAAAGGGGGAAGTTGG + Intergenic
1031877098 7:127154174-127154196 CCTTTTGCAAAGTTGGAAGCTGG - Intronic
1032369271 7:131329534-131329556 GATTATGGACAGTTGGGAATTGG + Intronic
1034326599 7:150240388-150240410 GCTGATGAGAAGTTGGAAGTTGG + Intergenic
1034766612 7:153728885-153728907 GCTGATGAGAAGTTGGAAGTTGG - Intergenic
1034768146 7:153747135-153747157 GATTATTCCAACTTGGAATTGGG + Intergenic
1035999569 8:4585322-4585344 GATTAGGCAAAGTTGAAAAGAGG + Intronic
1039683508 8:39769420-39769442 GGTAATGCAAAGCTGGAAGCAGG - Exonic
1041520000 8:58745388-58745410 GCAAATGCAAAGTTTGAAGTTGG - Intergenic
1042621727 8:70713758-70713780 GGTAAAGCAAAGTTGGATGTGGG + Intronic
1045805247 8:106152006-106152028 TATAAAGCAAAGTTGGAAGCTGG - Intergenic
1050272045 9:3956719-3956741 GATTATTCAAAGTTGGCACATGG - Intronic
1053206984 9:36194645-36194667 GAATGTGGAAAGTTGAAAGTGGG + Intronic
1054948329 9:70821288-70821310 AATTATTCAGAGGTGGAAGTAGG + Intronic
1056033665 9:82581767-82581789 GATTATGCAAAGGTTCAAATAGG - Intergenic
1058510454 9:105712213-105712235 GGTTATTTAAAGTGGGAAGTCGG - Intronic
1060033558 9:120235804-120235826 GGTTGGGCAAAGTGGGAAGTGGG - Intergenic
1060764174 9:126281545-126281567 AATCAGCCAAAGTTGGAAGTCGG - Intergenic
1060795978 9:126513603-126513625 GATTATGCACACCTGGAAGGAGG + Intergenic
1187222081 X:17337912-17337934 GAGTTTTCAAAGATGGAAGTGGG - Intergenic
1189646295 X:43136163-43136185 GATTATGAAAAGTCTGAATTCGG + Intergenic
1190927140 X:54920706-54920728 GAGAATGGAAAGTTGAAAGTAGG + Intronic
1192058439 X:67797842-67797864 ACTTATGAAAAGGTGGAAGTGGG + Intergenic
1194044986 X:88991646-88991668 GATAATGCAAAGTTAGCAGGGGG - Intergenic
1194624632 X:96213673-96213695 ACTTATGCAATGTTTGAAGTGGG + Intergenic
1197698028 X:129571867-129571889 GTTTAGGCAAAGTTGGGAGTAGG - Intronic
1198464372 X:136891506-136891528 GATAATGTCAAGTGGGAAGTTGG - Intergenic
1198657994 X:138935516-138935538 GATTTGGCAGAGTTGGAAGAAGG - Intronic
1202203202 Y:22376382-22376404 GATTATGAGAGGTTGGAAGGAGG - Intronic